Search
Amprolium
go.drugbank.com/drugs/DB11374ExperimentalVet approvedAmprolium is a coccidiostat used in poultry.
Synonyms: 1-((4-amino-2-Propyl-5-pyrimidinyl)methyl)-2-picolinium chlorideProducts: AMPRO 200mg/ml Oral Solution, AMPROLOX 20% PowderFerrous bisglycinate
go.drugbank.com/drugs/DB11210ApprovedFerrous bisglycinate is a chelate that is used as a source of dietary iron. … Forming a ring structure when reacting with glycine, ferrous bisglycinate acts as both a chelate and a nutritionally functional [A27250].
Mixtures: Folika-MG, Virt-Bal DHA PlusAvapritinib
go.drugbank.com/drugs/DB15233ApprovedInvestigationalAvapritinib was granted FDA approval on 9 January 2020 [L40363] and EMA approval on 24 September 2020.[L41464]
Categories: Cytochrome P-450 Substrates, Cytochrome P-450 CYP2C9 InhibitorsIMT504
go.drugbank.com/drugs/DB17792InvestigationalIMT504, a non-CpG 24-mer oligodeoxynucleotide, is an immunomodulatory oligonucleotide currently being investigated as a rabies vaccine.[A259467]
Synonyms: PyNTTTTGT class of oligodeoxynucleotide with a 24-base single chain composed of nucleotide sequence 5'TCATCATTTTGTCATTTTGTCATT 3', DNA, D(P-THIO)(T-C-A-T-C-A-T-T-T-T-G-T-C-A-T-T-T-T-G-T-C-A-T-T)Ademetionine
go.drugbank.com/drugs/DB00118ApprovedInvestigationalNutraceuticalIt possesses anti-inflammatory activity and has been used in treatment of chronic liver disease. (From Merck, 11th ed)
Mixtures: HEPATAMINE %8 500 ML(SETLI), HEPATAMINE %8 500 ML(SETSIZ)Categories: Cytochrome P-450 CYP2E1 Inhibitors, Cytochrome P-450 Enzyme InhibitorsInterferon alfacon-1
go.drugbank.com/drugs/DB00069ApprovedWithdrawnInterferon alfacon-1 differs from interferon alfa-2b at 20/166 amino acids (88% homology), and comparison with interferon-beta shows identity at over 30% of the amino acid positions. … This protein has a molecular weight of 19,434 daltons.
Categories: Cytochrome P-450 CYP1A2 Inhibitors, Cytochrome P-450 Enzyme InhibitorsThioproperazine
go.drugbank.com/drugs/DB01622ApprovedIt is virtually without antiserotonin and hypotensive action and has no antihistaminic property. … Thioproperazine has a marked cataleptic and antiapomorphine activity associated with relatively slight sedative, hypothermic and spasmolytic effects.
Synonyms: N,N-Dimethyl-10-[3-(4-methyl-1-piperazinyl)propyl]-10H-phenothiazine-2-sulfonamide, 2-dimethylsulfamido-(10-(3-1-methylpiperazinyl-4)propyl)-phenothiazineCategories: Serotonin 5-HT1 Receptor Antagonists, Serotonin 5-HT2 Receptor Antagonists13-deoxydoxorubicin
go.drugbank.com/drugs/DB05706InvestigationalGPX-100 is an anthracycline anticancer drug that belongs to the family of drugs called antitumor antibiotics.
Pibrentasvir
go.drugbank.com/drugs/DB13878ApprovedInvestigationalIn clinical trials, this combination therapy achieved SVR12 rate, or undetectable Hepatitis C for twelve or more weeks after the end of treatment, of ≥93% across genotypes 1a, 2a, 3a, 4, 5 and 6 [L940] … Pibrentasvir is available as an oral combination therapy with [DB13879] under the brand name Mavyret.
Mixtures: MAVİRET 100 MG/40 MG FİLM KAPLI TABLET, 84 ADET, MAVIRET® 100/40 MG TABLETAS RECUBIERTASCategories: Cytochrome P-450 CYP3A Inhibitors, Cytochrome P-450 CYP1A2 Inhibitors