Search
Fingolimod
go.drugbank.com/drugs/DB08868ApprovedInvestigationalIt was developed by Novartis and initially approved by the FDA in 2010.[L12651] Fingolimod was also studied for the treatment of COVID-19, the disease caused by infection with the SARS-CoV-2 virus.
CX-051869
go.drugbank.com/drugs/DB31656ApprovedCX-051869 is a COVID-19 mRNA vaccine encoding the pre-fusion stabilized Spike glycoprotein (S) of the SARS-CoV-2 Omicron variant lineage LP.8.1.
Paeonia lactiflora root
go.drugbank.com/drugs/DB16595InvestigationalSynonyms: Bai shao, Bai shao rootDoconexent
go.drugbank.com/drugs/DB03756ApprovedInvestigationalA mixture of fish oil and primrose oil, doconexent is used as a high-docosahexaenoic acid (DHA) supplement. DHA is a 22 carbon chain with 6 cis double bonds with anti-inflammatory effects.
Mixtures: Virt-Bal DHA Plus, Triveen-PRx RNFTribulus terrestris fruit
go.drugbank.com/drugs/DB14305InvestigationalTribulus terrestris fruit is a plant/plant extract used in some OTC (over-the-counter) products. It is not an approved drug.
Synonyms: Bai Ji LiCX-046684
go.drugbank.com/drugs/DB19414ApprovedCX-046684 is a COVID-19 mRNA vaccine encoding the pre-fusion stabilized Spike glycoprotein (S) of the SARS-CoV-2 Omicron variant lineage KP.2.
Docusate
go.drugbank.com/drugs/DB11089ApprovedRecently there has been pressure to stop prescribing docusate as it has been identified as an ineffective medicine[A176972,A176987,L5912]. … Additionally, it does not appear to lessen symptoms associated with constipation such as abdominal cramps. Still docusate is available in over-the-counter products as a common laxative.
Mixtures: Triveen-PRx RNF, Folivane-PRx DHABamlanivimab
go.drugbank.com/drugs/DB15718ApprovedInvestigational[A224039, L15311, L15316] Bamlanivimab is a neutralizing IgG1κ mAb directed against the SARS-CoV-2 spike (S) protein, which is described to block viral entry into human cells. … [L20979] Based on phase 2 clinical trial (BLAZE-1) interim results, bamlanivimab was granted Emergency Use Authorization (EUA) by the FDA on November 10, 2020.
IMT504
go.drugbank.com/drugs/DB17792InvestigationalIMT504, a non-CpG 24-mer oligodeoxynucleotide, is an immunomodulatory oligonucleotide currently being investigated as a rabies vaccine.[A259467]
Synonyms: PyNTTTTGT class of oligodeoxynucleotide with a 24-base single chain composed of nucleotide sequence 5'TCATCATTTTGTCATTTTGTCATT 3'