Search
Minigastrin
go.drugbank.com/drugs/DB19196InvestigationalMinigastrin is under investigation in clinical trial NCT06155994 (68ga-dota-mgs5 PET/CT in Patients With Advanced Neuroendocrine Tumours).
Synonyms: L-phenylalaninamide, l-leucyl-l-.alpha.-aspartyl-l-.alpha.-aspartyl-l-.alpha.-aspartyl-l-.alpha.-aspartyl-l-.alpha.-aspartyl-l-alanyl-l-tyrosylglycyl-l-tryptophyl-l-leucyl-l-.alpha.-aspartyl-IMT504
go.drugbank.com/drugs/DB17792InvestigationalIMT504, a non-CpG 24-mer oligodeoxynucleotide, is an immunomodulatory oligonucleotide currently being investigated as a rabies vaccine.[A259467]
Synonyms: DNA, D(P-THIO)(T-C-A-T-C-A-T-T-T-T-G-T-C-A-T-T-T-T-G-T-C-A-T-T), PyNTTTTGT class of oligodeoxynucleotide with a 24-base single chain composed of nucleotide sequence 5'TCATCATTTTGTCATTTTGTCATT 3'SER-100
go.drugbank.com/drugs/DB16013InvestigationalSER-100 is under investigation in clinical trial NCT01987284 (SER100 in Isolated Systolic Hypertension).
DaxibotulinumtoxinA
go.drugbank.com/drugs/DB17929ApprovedInvestigationalIt is a botulinum toxin without accessory proteins purified from the bacterium _Clostridium botulinum_ type A,[L47840] the gram-positive anaerobic bacterium primarily present in soil. … [L47870] DAXI or DAXXIFY, a product of daxibotulinumtoxinA, incorporates RTP004, a proprietary synthetic stabilizing peptide for enhanced product stability.[A261080, A261085]
Categories: Botulinum Toxins, Type ABaclofen
go.drugbank.com/drugs/DB00181ApprovedInvestigationalBaclofen is a gamma-aminobutyric acid (GABA) agonist used as a skeletal muscle relaxant. … [A245338] Baclofen was reintroduced in 1971 as a treatment for spasticity and was later approved by the FDA in 1977.
Mixtures: Innoprax-5Categories: GABA-B Receptor AgonistsDengueCide
go.drugbank.com/drugs/DB18546ExperimentalDengueCide is a nonjugate of a dengue virus specific small chemical ligand and an amphiphilic PEG based polymer
Pramocaine
go.drugbank.com/drugs/DB09345ApprovedPramocaine (also known as pramoxine or pramoxine HCI) is a topical anesthetic and antipruritic.
Mixtures: Pomada De La Campana Triple Antibiotic Pain Relief, L-Topical CALAMINE 8% PRAMOXINE HCL 1%Categories: Heterocyclic Compounds, 1-RingFlorilglutamic acid F-18
go.drugbank.com/drugs/DB15041InvestigationalFlorilglutamic acid F-18 is under investigation in clinical trial NCT02370563 (PET Imaging of Intracranial Cancers With 18F-FSPG).
Synonyms: Florilglutamic acid F-18Mecobalamin
go.drugbank.com/drugs/DB03614ApprovedInvestigationalMixtures: L-Methyl-B6-B12, L-Methyl MC NACCategories: Vitamin B Complex, Heterocyclic Compounds, 1-RingBrinzolamide
go.drugbank.com/drugs/DB01194Approved[A2051] Brinzolamide was approved by the FDA in 1998 as a standalone product and in 2013 as a combination product with brimonidine tartrate. … [L35310,L35315] In Europe, it was also approved as a combination product with timolol in 2008.[L35320]
Mixtures: BRINZOLAMIDE E TIMOLOLO EG, BRINZOLAMIDE E TIMOLOLO EGCategories: Cytochrome P-450 Substrates, Cytochrome P-450 CYP2A6 Substrates