Search
Rotenone
go.drugbank.com/drugs/DB11457ExperimentalVet approvedRotenone is an isoflavone compound that naturally occurs in the jicama vine plant as well as many Fabaceae plants. It has broad spectrum insecticide and pesticide activity and is also toxic to fish.
Synonyms: 5'β-rotenone, [2R-(2α,6aα,12aα)]-1,2,12,12a-tetrahydro-8,9-dimethoxy-2-(1-methylethenyl)[1]benzopyrano[3,4-b]furo[2,3-H][1]benzopyran-6(6aH)-oneCategories: Heterocyclic Compounds, 1-Ring, Heterocyclic Compounds, 2-RingIMT504
go.drugbank.com/drugs/DB17792InvestigationalIMT504, a non-CpG 24-mer oligodeoxynucleotide, is an immunomodulatory oligonucleotide currently being investigated as a rabies vaccine.[A259467]
Synonyms: PyNTTTTGT class of oligodeoxynucleotide with a 24-base single chain composed of nucleotide sequence 5'TCATCATTTTGTCATTTTGTCATT 3', DNA, D(P-THIO)(T-C-A-T-C-A-T-T-T-T-G-T-C-A-T-T-T-T-G-T-C-A-T-T)Peginterferon alfa-2a
go.drugbank.com/drugs/DB00008ApprovedInvestigationalWhen combined together, Peginterferon alfa-2a and [DB00811] have been shown to achieve a SVR between 36% for genotype 1 and 59% for genotypes 2-6 after 48 weeks of treatment. … HCV is a single-stranded RNA virus that is categorized into nine distinct genotypes, with genotype 1 being the most common in the United States, and affecting 72% of all chronic HCV patients [L852].
Categories: Cytochrome P-450 CYP1A2 Inhibitors, Cytochrome P-450 Enzyme InhibitorsProducts: PEGASYS 180 MCG/0.5 ML ENJEKSİYONLUK ÇÖZELTİ İÇEREN KULLANIMA HAZIR ŞIRINGA, 4 ADET, PEGASYS 180 MCG/0.5 ML ENJEKSİYONLUK ÇÖZELTİ İÇEREN KULLANIMA HAZIR ŞIRINGA, 1 ADETTeduglutide
go.drugbank.com/drugs/DB08900ApprovedInvestigationalTeduglutide is a glucagon-like peptide-2 (GLP-2) analogue. It is made up of 33 amino acids and is manufactured using a strain of Escherichia coli modified by recombinant DNA technology. … Teduglutide differs from GLP-2 by one amino acid (alanine is substituted by glycine).
Synonyms: Gly(2)-GLP-2, (Gly2)GLP-2Categories: Glucagon-like Peptide-2 (GLP-2) Agonists, GLP-2 AnalogRozanolixizumab
go.drugbank.com/drugs/DB14919ApprovedInvestigational[L47122] This is due to the efficacy demonstrated in the pivotal Phase 3 MycarinG study (NCT03971422).[L47122] Rozanolixizumab was also approved by the European Commission on January 5, 2024.[L50973] … Rozanolixizumab is a humanized high-affinity anti-human neonatal Fc receptor (FcRn) monoclonal antibody (IgG4P) targeting the immunoglobulin G (IgG).
Products: Rystiggo 280 mg/2 ml Enjeksiyonluk Çözelti, 1 adetTiotropium
go.drugbank.com/drugs/DB01409ApprovedInvestigational[A180163,L7084,L7087,L7090,L7093] Tiotropium acts mainly on M3 muscarinic receptors located in the airways to produce smooth muscle relaxation and bronchodilation. … [A180163] Tiotropium was granted FDA approval on 30 January 2004.[L7084]
Mixtures: TROFAS 9/50/100 MCG INHALASYON IÇIN TOZ IÇEREN KAPSÜL, 120 KAPSÜL, TROFAS 9/50/250 MCG INHALASYON IÇIN TOZ IÇEREN KAPSÜL, 120 KAPSÜLCategories: Cytochrome P-450 Substrates, Cytochrome P-450 CYP3A SubstratesPhenolphthalein
go.drugbank.com/drugs/DB04824ApprovedWithdrawnPhenolphthalein was withdrawn in Canada due to concerns with carcinogenicity in 1997.
Synonyms: 3,3-Bis(4-hydroxyphenyl)phthalideInternational brands: Feen-a-mint gum, Feen-a-mint laxative mintsObinutuzumab
go.drugbank.com/drugs/DB08935ApprovedInvestigationalObinutuzumab is a humanized anti-CD20 monoclonal antibody designed to treat B-cell malignancies. … [L54521] Like other drugs in its class, obinutuzumab targets the CD20 antigen expressed on the surface of pre-B and mature B lymphocytes, mediating B-cell lysis.
Products: GAZYVA ® CONCENTRADO PARA SOLUCIÓN PARA INFUSIÓN 1000 MG / VIAL 40 ML, GAZYVA 1000 MG IV İNFÜZYONLUK KONSANTRE ÇÖZELTİ, 1 ADETDaptomycin
go.drugbank.com/drugs/DB00080ApprovedInvestigational[A231379, A231384, L32534] Chemically, daptomycin comprises 13 amino acids, including several non-standard and D-amino acids, with the C-terminal 10 amino acids forming an ester-linked ring and the N-terminal … Daptomycin is a cyclic lipopeptide antibacterial agent with a broad spectrum of activity against Gram-positive bacteria, including methicillin-susceptible and -resistant _Staphylococcus aureus_ (MSSA/MRSA
Categories: P-glycoprotein substratesProducts: CUBICIN 350 MG ENJEKSİYONLUK ÇÖZELTİ İÇİN TOZ İÇEREN FLAKON, 30 ADET, CUBICIN 500 MG ENJEKSİYONLUK ÇÖZELTİ İÇİN TOZ İÇEREN FLAKON, 30 ADETMetandienone
go.drugbank.com/drugs/DB13586ApprovedWithdrawn[A254432] In the US, metandienone is a controlled substance under the Controlled Substances Act.[L44057] … Although it is prohibited in and outside competition by the World Anti-Doping Agency, metandienone continues to be marketed and misused as a performance-enhancing drug in sports.
Products: ไดอาบอล - 5, SIROBOLIN ŞURUP, 120 ML