Search
Raloxifene
go.drugbank.com/drugs/DB00481ApprovedInvestigationalHowever, it has a negligible effect on altering the development and progression of breast cancer itself. … In addition, a clinical study consisting of postmenopausal women with documented coronary heart disease or at increased risk for coronary events showed an increased risk for fatal stroke with raloxifene
Synonyms: (2-(4-Hydroxyphenyl)-6-hydroxybenzo(b)thien-3-yl)(4-(2-(1-piperidinyl)ethoxy)phenyl)methanoneCategories: P-glycoprotein substrates, Cytochrome P-450 CYP2B6 InhibitorsMinocycline
go.drugbank.com/drugs/DB01017ApprovedInvestigational[A190723] Minocycline was granted FDA approval on 30 June 1971.[L11695] … [A190681] It is a second generation tetracycline antibiotic that is active against gram-negative and gram-positive bacteria.
Synonyms: (4S,4aS,5aR,12aS)-4,7-bis(dimethylamino)-3,10,12,12a-tetrahydroxy-1,11-dioxo-1,4,4a,5,5a,6,11,12a-octahydrotetracene-2-carboxamide, 7-Dimethylamino-6-demethyl-6-deoxytetracyclineProducts: Udima 50 mg - Kapseln, Riva-minocycline 50 mgEnzalutamide
go.drugbank.com/drugs/DB08899ApprovedInvestigationalCompared to the average time of 10 to 15 years for a drug to go from pre-clinical to clinical studies, enzalutamide was developed relatively rapidly.[A252667] … [L40639] It is a second-generation antiandrogen agent that the FDA approved on August 31, 2012.
Categories: Heterocyclic Compounds, 1-Ring, P-glycoprotein inhibitorsProducts: XTANDI ® 40 MG, XTANDI® 40 MGIMT504
go.drugbank.com/drugs/DB17792InvestigationalIMT504, a non-CpG 24-mer oligodeoxynucleotide, is an immunomodulatory oligonucleotide currently being investigated as a rabies vaccine.[A259467]
Synonyms: DNA, D(P-THIO)(T-C-A-T-C-A-T-T-T-T-G-T-C-A-T-T-T-T-G-T-C-A-T-T), PyNTTTTGT class of oligodeoxynucleotide with a 24-base single chain composed of nucleotide sequence 5'TCATCATTTTGTCATTTTGTCATT 3'Choline
go.drugbank.com/drugs/DB00122ApprovedInvestigationalNutraceuticalIt is important as a precursor of acetylcholine, as a methyl donor in various metabolic processes, and in lipid metabolism. … A basic constituent of lecithin that is found in many plants and animal organs.
Mixtures: Stress B With 1000 Mg Vitamin C, Sentralopram AM-10Categories: Vitamin B ComplexDigitoxin
go.drugbank.com/drugs/DB01396ApprovedWithdrawnA cardiac glycoside sometimes used in place of digoxin. It has a longer half-life than digoxin; toxic effects, which are similar to those of digoxin, are longer lasting. … (From Martindale, The Extra Pharmacopoeia, 30th ed, p665)
Categories: P-glycoprotein substrates with a Narrow Therapeutic Index, Cytochrome P-450 CYP3A4 Substrates with a Narrow Therapeutic IndexProducts: Digimerck 0,1 mg/ml - Injektionslösung, Digimerck 0,07 mg - TablettenSpiramycin
go.drugbank.com/drugs/DB06145ApprovedInvestigationalWithdrawnSpiramycin is a 16-membered ring macrolide discovered in 1952 as a product of Streptomyces ambofaciens that has been available in oral formulations since 1955, and parenteral formulations since 1987. … Spiramycin is a primarily bacteriostatic macrolide antimicrobial agent with activity against Gram-positive cocci and rods, Gram-negative cocci and also Legionellae, mycoplasmas, chlamydiae, some types
Mixtures: METİRASİN 1,5 MIU/250 MG FİLM KAPLI TABLET, 10 ADET, METİRASİN 1,5 MIU/250 MG FILM TABLET, 14 ADETCategories: Cytochrome P-450 CYP3A Inhibitors, Cytochrome P-450 Enzyme InhibitorsRotenone
go.drugbank.com/drugs/DB11457ExperimentalVet approvedIt has broad spectrum insecticide and pesticide activity and is also toxic to fish.
Categories: Heterocyclic Compounds, 1-Ring, Heterocyclic Compounds, 2-RingSynonyms: [2R-(2α,6aα,12aα)]-1,2,12,12a-tetrahydro-8,9-dimethoxy-2-(1-methylethenyl)[1]benzopyrano[3,4-b]furo[2,3-H][1]benzopyran-6(6aH)-one, 5'β-rotenoneBetiatide
go.drugbank.com/drugs/DB14082ApprovedProducts: TECHNESCAN MAG3 KIT 1 mg/vial, Renoscint MAG3 1 mg Kit für ein radioaktives ArzneimittelTeduglutide
go.drugbank.com/drugs/DB08900ApprovedInvestigationalTeduglutide is a glucagon-like peptide-2 (GLP-2) analogue. It is made up of 33 amino acids and is manufactured using a strain of Escherichia coli modified by recombinant DNA technology. … The significance of this substitution is that teduglutide is longer acting than endogenous GLP-2 as it is more resistant to proteolysis from dipeptidyl peptidase-4. FDA approved on December 21, 2012.
Synonyms: Gly(2)-GLP-2, (Gly2)GLP-2Categories: Glucagon-like Peptide-2 (GLP-2) Agonists, GLP-2 Analog