Search
AVI-4065
go.drugbank.com/drugs/DB05620InvestigationalAVI-4065, a phosphorodiamidate Morpholino oligomer (PMO), is an investigational antisense HCV drug. It was developed by Sarepta Therapeutics, Inc. … After phase II trials it was cancelled due to lack of potency. [L2917]
Ohmefentanyl
go.drugbank.com/drugs/DB01570ExperimentalIllicitOhmefentanyl is an extremely potent opioid analgesic drug which selectively binds to the µ-opioid receptor. The Chinese have recorded ohmefentanyl as having a potency that is 6,300 times morphine. … Ohmefentanyl is one of the most potent μ -receptor agonists known, comparable to super-potent opioids such as carfentanil and etorphine which are used for tranquilizing large animals such as elephants
Dehydrocholic acid
go.drugbank.com/drugs/DB11622ApprovedDehydrocholic acid is a synthetic bile acid that was prepared from the oxidation of cholic acid with chromic acid [A33022]. It has been used for stimulation of biliary lipid secretion.
Nequinate
go.drugbank.com/drugs/DB11433ExperimentalVet approvedNequinate is an antiprotozoan used as a coccidiostat for poultry and rabbits. Nequinate belongs to the family of Hydroquinolones. … These are compounds containing an hydrogenated quinoline bearing a ketone group.
Etuvetidigene Autotemcel
go.drugbank.com/drugs/DB17593ApprovedInvestigational[L54693] WAS is a rare X-linked disorder caused by a mutation in the gene encoding the WAS protein, leading to a compromised immune system. … Etuvetidigene autotemcel is an autologous gene therapy which includes hematopoietic stem cells (HSCs) that have been genetically modified ex vivo.
Glisoxepide
go.drugbank.com/drugs/DB01289InvestigationalIt inhibits the uptake of bile acids into isolated rat hepatocytes. However it inhibits taurocholate uptake only in the absence of sodium ions.
Ligandrol
go.drugbank.com/drugs/DB13934InvestigationalLigandrol is an investigational selective androgen receptor modulator (SARM) for treatment of conditions such as muscle wasting and osteoporosis.
NS-398
go.drugbank.com/drugs/DB14060ExperimentalNS-398 is a COX-2 inhibitor. It was developed as part of the mechanistic study of the cyclooxygenases.
MaaT013
go.drugbank.com/drugs/DB18648InvestigationalMaaT013 is an allogeneic fecal microbiota therapy. It is being investigated for the treatment of Graft-Versus-Host Disease.
IMT504
go.drugbank.com/drugs/DB17792InvestigationalIMT504, a non-CpG 24-mer oligodeoxynucleotide, is an immunomodulatory oligonucleotide currently being investigated as a rabies vaccine.[A259467]
Synonyms: DNA, D(P-THIO)(T-C-A-T-C-A-T-T-T-T-G-T-C-A-T-T-T-T-G-T-C-A-T-T), PyNTTTTGT class of oligodeoxynucleotide with a 24-base single chain composed of nucleotide sequence 5'TCATCATTTTGTCATTTTGTCATT 3'