Search
N-Ethyl-5'-Carboxamido Adenosine
go.drugbank.com/drugs/DB03719ExperimentalA stable adenosine A1 and A2 receptor agonist. Experimentally, it inhibits cAMP and cGMP phosphodiesterase activity. [PubChem]
Relugolix
go.drugbank.com/drugs/DB11853ApprovedInvestigationalRelugolix is a gonadotropin-releasing hormone (GnRH) receptor antagonist used in the treatment of several hormone-responsive conditions. … administration - and therefore provides a less burdensome therapeutic option for patients who might otherwise require clinic visits for administration by healthcare professionals.
Captodiame
go.drugbank.com/drugs/DB09014ExperimentalCaptodiame, also known as captodiamine, is an antihistamine which is used as a sedative and anxiolytic. It is a derivative of diphenhydramine.
Rotenone
go.drugbank.com/drugs/DB11457ExperimentalVet approvedRotenone is an isoflavone compound that naturally occurs in the jicama vine plant as well as many Fabaceae plants. It has broad spectrum insecticide and pesticide activity and is also toxic to fish.
Categories: Compounds used in a research, industrial, or household settingMotexafin lutetium
go.drugbank.com/drugs/DB05296InvestigationalMotexafin lutetium is a pentadentate aromatic metallotexaphyrin with photosensitizing properties. … Motexafin lutetium (MLu) is a second-generation photosensitizer for photodynamic therapy (PDT) of cancer. It belongs to the family of drugs called metallotexaphyrins. Also called lutetium texaphyrin.
Ligandrol
go.drugbank.com/drugs/DB13934InvestigationalLigandrol is an investigational selective androgen receptor modulator (SARM) for treatment of conditions such as muscle wasting and osteoporosis.
IMT504
go.drugbank.com/drugs/DB17792InvestigationalIMT504, a non-CpG 24-mer oligodeoxynucleotide, is an immunomodulatory oligonucleotide currently being investigated as a rabies vaccine.[A259467]
Synonyms: DNA, D(P-THIO)(T-C-A-T-C-A-T-T-T-T-G-T-C-A-T-T-T-T-G-T-C-A-T-T), PyNTTTTGT class of oligodeoxynucleotide with a 24-base single chain composed of nucleotide sequence 5'TCATCATTTTGTCATTTTGTCATT 3'Mersalyl
go.drugbank.com/drugs/DB09338ExperimentalMersalyl is the sodium salt form of mersalyl acid, a mercurial diuretic. It is an outdated drug, and its approval has been discontinued by the FDA. … The sodium salt of a mercury-containing derivative of salicylamide, was formerly used (often in combination with theophylline) to treat edema, due to its powerful diuretic properties [L1577].
VLTS-589
go.drugbank.com/drugs/DB05430InvestigationalVLTS-589 consists of plasmid encoding the angiomatrix protein Del-1 in conjunction with poloxamer 188 for the treatment of peripheral vascular disease.