Search
Misoprostol
go.drugbank.com/drugs/DB00929ApprovedInvestigationalMisoprostol is a prostaglandin analog used to reduce the risk of NSAID related ulcers, manage miscarriages, prevent post partum hemorrhage, and also for first trimester abortions.
Mixtures: ARTHROTEC 75 MG 10 TABLET, DIFEMIS 50 MG/0.2 MG TABLET, 20 ADETCategories: Prostaglandins E, SyntheticBesigomsin
go.drugbank.com/drugs/DB20894ExperimentalBesigomsin is a small molecule drug. Besigomsin has a monoisotopic molecular weight of 416.18 Da.
Synonyms: Gomisin a, (+)-gomisin aCategories: Compounds used in a research, industrial, or household setting, P-glycoprotein inhibitorsBakuchiol
go.drugbank.com/drugs/DB16102InvestigationalBakuchiol is under investigation in clinical trial NCT03112863 (Comparison of the Cosmetic Effects of Bakuchiol and Retinol).
Synonyms: Sytenol a, (s)-bakuchiolPancrelipase amylase
go.drugbank.com/drugs/DB11065ApprovedInvestigational[T177] The pancrelipase amylase is a single polypeptide chain containing two SH groups and four disulfide bridges. … Pancrelipase, in general, is composed of a mixture of pancreatic enzymes which include amylases, lipases, and proteases. These enzymes are extracted from porcine pancreatic glands.
Synonyms: Amylase A, 1,4-alpha-D-Glucan glucanohydrolaseMixtures: Pancrease Mt 10, Pancrease Mt 20Interferon beta-1a
go.drugbank.com/drugs/DB00060ApprovedInvestigationalHuman interferon beta (166 residues), glycosylated, MW=22.5kD. It is produced by mammalian cells (Chinese Hamster Ovary cells) into which the human interferon beta gene has been introduced.
Synonyms: Interferon beta 1-a, IFN β-1aCategories: interferon beta-1a, Interferon Type IMupirocin
go.drugbank.com/drugs/DB00410ApprovedInvestigationalVet approvedMupirocin, formerly termed pseudomonic acid A,[A178531] is a novel antibacterial agent with a unique chemical structure and mode of action apart from other antibiotic agents. … Produced by fermentation using the organism _Pseudomonas fluorescens_, mupirocin is a naturally-occurring antibiotic that displays a broad-specturm activity against many gram-positive bacteria and certain
Synonyms: Pseudomonic acid A, 9-[(E)-4-[(2S,3R,4R,5S)-3,4-dihydroxy-5-[[(2S,3S)-3- [(2S,3S)-3-hydroxybutan-2-yl]oxiran-2-yl]methyl] oxan-2-yl]-3-methylbut-2-enoyl]oxynonanoic acidInternational brands: T-BactIMT504
go.drugbank.com/drugs/DB17792InvestigationalIMT504, a non-CpG 24-mer oligodeoxynucleotide, is an immunomodulatory oligonucleotide currently being investigated as a rabies vaccine.[A259467]
Synonyms: DNA, D(P-THIO)(T-C-A-T-C-A-T-T-T-T-G-T-C-A-T-T-T-T-G-T-C-A-T-T), PyNTTTTGT class of oligodeoxynucleotide with a 24-base single chain composed of nucleotide sequence 5'TCATCATTTTGTCATTTTGTCATT 3'AOC-1020
go.drugbank.com/drugs/DB18621InvestigationalAOC-1020 is an antibody oligonucleotide conjugate, comprised of a human transferrin receptor 1 targeting, effector function null, humanized IgG1 antibody, a MCC maleimide linker, and a double-stranded
Synonyms: An antibody oligonucleotide conjugate, comprised of a human transferrin receptor 1 targeting, effector function null, humanized IgG1 antibody, a MCC maleimide linker, and a double-stranded siRNA oligonucleotideTN-201
go.drugbank.com/drugs/DB18700InvestigationalTN-201 is a gene therapy comprising a native AAV9 capsid with a genomic cassette containing a cardiomyocyte-specific promoter and the wild-type human MYBPC3 gene.
Synonyms: Native AAV9 capsid with a genomic cassette containing a cardiomyocyte-specific promoter and the wild-type human MYBPC3 geneNeutramycin
go.drugbank.com/drugs/DB20809ExperimentalNeutramycin has a monoisotopic molecular weight of 686.35 Da. … Neutramycin is a small molecule drug. The usage of the INN stem '-mycin' in the name indicates that Neutramycin is a antibiotic, produced by Streptomyces strain.
Synonyms: Neutramycin a, Chalcomycin, 6-demethyl-