Search
Ponsegromab
go.drugbank.com/drugs/DB18943InvestigationalPonsegromab is under investigation in clinical trial NCT05492500 (A Study of Ponsegromab in People With Heart Failure).
Synonyms: Immunoglobulin g1 (237-alanine,238-alanine,240-alanine), anti-(human growth differentiation factor 15) (human-mus musculus monoclonal pf-06946860 .gamma.1-chain), disulfide with human-mus musculus monoclonalBCG vaccine
go.drugbank.com/drugs/DB12768ApprovedInvestigationalWithdrawnBCG vaccine has been investigated for the treatment of Neoplasms, Bladder Cancer, Neoplasms by Site, Urologic Diseases, and Urologic Neoplasms, among others.
Products: SII-ONCO-BCG (Powder for Intravesical Instillation) BCG Live USP. 1 vial of 40 mg/ml, BCG CULTURE SSI 30 MG 4 VIALIvonescimab
go.drugbank.com/drugs/DB18931InvestigationalIvonescimab is under investigation in clinical trial NCT05184712 (Phase 3 Clinical Study of AK112 for NSCLC Patients).
Synonyms: IMMUNOGLOBULIN G1 (240-ALANINE,241-ALANINE), ANTI-(HUMAN VASCULAR ENDOTHELIAL GROWTH FACTOR A) (HUMAN-MUS MUSCULUS MONOCLONAL AK112 .GAMMA.1-CHAIN) FUSION PROTEIN WITH PEPTIDE LINKER (GGGS)4 FUSION PROTEINMethyl salicylate
go.drugbank.com/drugs/DB09543ApprovedInvestigationalVet approvedIt forms a colorless to yellow or reddish liquid and exhibits a characteristic odor and taste of wintergreen. … It is used as a flavoring agent in chewing gums and mints in small concentrations and added as antiseptic in mouthwash solutions.
Synonyms: 2-Carbomethoxyphenol, 2-(Methoxycarbonyl)phenolMixtures: KAMFOLIN 150 MG/G+100 MG/G MERHEM, 50 G, Re-Lieved 3 in 1 PatchFremanezumab
go.drugbank.com/drugs/DB14041ApprovedInvestigationalFremanezumab is a humanized monoclonal antibody targeted against human calcitonin gene-related peptide (CGRP) for the prevention of migraine headaches. … [L11749] It was developed by Teva Pharmaceuticals USA and approved by the FDA in September 2018.
Products: AJOVY 225 MG/1,5 ML ENJEKSİYONLUK ÇÖZELTİ İÇEREN KULLANIMA HAZIR ENJEKTÖR, 1 ADET, AJOVY 225 MG/1,5 ML ENJEKSİYONLUK ÇÖZELTİ İÇEREN KULLANIMA HAZIR ENJEKTÖR, 3 ADETIMT504
go.drugbank.com/drugs/DB17792InvestigationalIMT504, a non-CpG 24-mer oligodeoxynucleotide, is an immunomodulatory oligonucleotide currently being investigated as a rabies vaccine.[A259467]
Synonyms: DNA, D(P-THIO)(T-C-A-T-C-A-T-T-T-T-G-T-C-A-T-T-T-T-G-T-C-A-T-T), PyNTTTTGT class of oligodeoxynucleotide with a 24-base single chain composed of nucleotide sequence 5'TCATCATTTTGTCATTTTGTCATT 3'Benzatropine
go.drugbank.com/drugs/DB00245ApprovedInvestigationalIt is a combination molecule between a tropane ring, similar to cocaine, and a diphenyl ether from the dialkylpiperazines determined to be a dopamine uptake inhibitor since 1970. … The generation of structure-activity relationships proved that benztropine derivatives with the presence of a chlorine substituent in the para position in one of the phenyl rings produces an increased
Categories: Cytochrome P-450 Substrates, Cytochrome P-450 CYP2D6 SubstratesSynonyms: benzhydryl 8-methyl-8-azabicyclo[3.2.1]oct-3-yl ether, 3α-benzhydryloxy-8-methyl-8-azabicyclo[3.2.1]octanePR1 leukemia peptide vaccine
go.drugbank.com/drugs/DB15276InvestigationalPR1 leukemia peptide vaccine is under investigation in clinical trial NCT00513578 (Vaccine Therapy and GM-CSF in Treating Patients With Low-Risk or Intermediate-Risk Myelodysplastic Syndrome).
Synonyms: PR-1, L-VALINE, L-VALYL-L-LEUCYL-L-GLUTAMINYL-L-.ALPHA.-GLUTAMYL-L-LEUCYL-L-ASPARAGINYL-L-VALYL-L-THREONYL-Pholcodine
go.drugbank.com/drugs/DB09209ApprovedIllicit[A31742] Pholcodine is not prescribed in the United States where it is classed as a Schedule I drug. It is categorized as Class B drug in the UK and officially taken out of the shelves in 2008. … Pholcodine formula is 3-o-morpholinoethylmorphine and it is classified as an antitussive which is defined as an opioid cough suppressant.
Mixtures: Rhynacol F SyrupCategories: Heterocyclic Compounds, 1-Ring, Heterocyclic Compounds with 4 or More RingsBelimumab
go.drugbank.com/drugs/DB08879ApprovedInvestigationalIt is produced by recombinant DNA technology in a murine cell (NS0) expression system. … [L42630] Belimumab was first approved by the FDA on March 9, 2011,[A251495] making it the newest drug to be approved for the treatment of SLE in more than 50 years.
Categories: Decreased B Lymphocyte Activation, B Lymphocyte Stimulator-specific InhibitorProducts: BENLYSTA 200 MG / 1 ML, BENLYSTA SUBCUTÁNEO 200 MG / 1 ML