Search
Evolocumab
go.drugbank.com/drugs/DB09303ApprovedInvestigationalIt is a subcutaneous injection approved by the FDA for individuals on maximum statin therapy who still require additional LDL-cholesterol lowering. … Evolocumab is a human IgG2 monoclonal antibody that targets the proprotein convertase subtilisin/kexin type 9 (PCSK9).
Products: REPATHA 140 MG/ML SC ENJEKSIYONLUK COZELTI ICEREN KULLANIMA HAZIR ENJEKTOR, 1 ADET, REPATHA 140 MG/ML SC ENJEKSIYONLUK COZELTI ICEREN KULLANIMA HAZIR KALEM, 1 ADETSomatostatin
go.drugbank.com/drugs/DB09099ApprovedInvestigationalWithdrawnIt is secreted by the D cells of the islets to inhibit the release of insulin and glucagon, and is also generated in the hypothalamus, where it inhibits the release of growth hormone and thyroid-stimulating … The actions of somatostatin are mediated via signalling pathways of G protein-coupled somatostatin receptors.
Categories: P-glycoprotein substrates, Cytochrome P-450 CYP3A InhibitorsSynonyms: Synthetic somatostatin-14Lactulose
go.drugbank.com/drugs/DB00581ApprovedInvestigationalLactulose is a synthetic disaccharide derivative of lactose that is most commonly used as a laxative agent despite also being formally indicated to serve as an adjunct therapy in treating portal-systemic … Organization's List of Essential Medicines as one of the most effective and safe medicines employed in a health system[L6205], data regarding its optimal place in therapy is often ambiguous.
Synonyms: 4-O-beta-D-Galactopyranosyl-D-fructose, 4-O-beta-D-Galactopyranosyl-D-fructofuranoseProducts: FLOROLAC 670MG/ML LOES Z E, Gen-lac - Liq 667mg/mlNicotinamide
go.drugbank.com/drugs/DB02701ApprovedInvestigationalAn important compound functioning as a component of the coenzyme NAD. Its primary significance is in the prevention and/or cure of blacktongue and pellagra. … Most animals cannot manufacture this compound in amounts sufficient to prevent nutritional deficiency and it therefore must be supplemented through dietary intake.
Synonyms: 3-pyridinecarboxamide, β-pyridinecarboxamideMixtures: MU LAB TURN AROUND 2W Refresh Ex, Tonicol Et A-D-C Ampoules/comprimesHaemophilus influenzae type B strain 20752 capsular polysaccharide tetanus toxoid conjugate antigen
go.drugbank.com/drugs/DB10990Approveda primary series with a Haemophilus b Conjugate Vaccine that is licensed for primarly immunization. … Haemophilus influenzae type b strain 20752 capsular polysaccharide tetanus toxoid conjugate antigen is an active immunization as a booster dose given intramuscularly to pediatric patients who have received
Synonyms: Haemophilus influenzae type B-PRP and tetanus toxoid conjugate (PRP-T), Haemophilus influenzae type B strain 20752 capsular polysaccharide tetanus toxoid conjugate antigenCategories: Inactivated Haemophilus Influenzae B VaccineEthiodized oil
go.drugbank.com/drugs/DB00965ApprovedInvestigationalEthiodized oil is used by injection as a radio-opaque contrast agent. The composition of the oil is comprised of iodine combined with ethyl esters of fatty acids of poppyseed oil.
Categories: Compounds used in a research, industrial, or household setting, X-Ray Contrast ActivityProducts: LİPİODUL ULTRA-FLUİD 480 MG/10 ML ENJEKSİYONLUK ÇÖZELTİ , 5 ML, LİPİODUL ULTRA-FLUİD 480 MG/10 ML ENJEKSİYONLUK ÇÖZELTİ, 10 MLAtracurium besylate
go.drugbank.com/drugs/DB00732ApprovedA non-depolarizing neuromuscular blocking agent with short duration of action. … Its lack of significant cardiovascular effects and its lack of dependence on good kidney function for elimination provide clinical advantage over alternate non-depolarizing neuromuscular blocking agents
Synonyms: Besilato de atracurioCategories: Heterocyclic Compounds, 2-RingIMT504
go.drugbank.com/drugs/DB17792InvestigationalIMT504, a non-CpG 24-mer oligodeoxynucleotide, is an immunomodulatory oligonucleotide currently being investigated as a rabies vaccine.[A259467]
Synonyms: DNA, D(P-THIO)(T-C-A-T-C-A-T-T-T-T-G-T-C-A-T-T-T-T-G-T-C-A-T-T), PyNTTTTGT class of oligodeoxynucleotide with a 24-base single chain composed of nucleotide sequence 5'TCATCATTTTGTCATTTTGTCATT 3'Lanadelumab
go.drugbank.com/drugs/DB14597ApprovedInvestigational[L4538] It is a fully human immunoglobulin, k-light-chain made in recombinant Chinese Hamster Ovary cells. … Lanadelumab, also known as DX-2930, is a human IgG1 monoclonal antibody designed for subcutaneous self-injection.
Categories: Drugs Used in Hereditary AngioedemaProducts: TAKHZYRO 300 MG/2 ML ENJEKSİYONLUK ÇÖZELTİ İÇEREN KULLANIMA HAZIR ENJEKTÖR, 1 ADET, TAKHZYRO 300 MG/2 ML ENJEKSİYONLUK ÇÖZELTİ İÇEREN KULLANIMA HAZIR ENJEKTÖR, 2 ADETRuxolitinib
go.drugbank.com/drugs/DB08877ApprovedInvestigationalIt is a potent and selective inhibitor of JAK1 and JAK2,[A229698] which are tyrosine kinases involved in cytokine signalling and hematopoiesis. … severe complications [L31968] thus the drug was not approved as a treatment for COVID-19.
Categories: Heterocyclic Compounds, 1-Ring, Cytochrome P-450 CYP2C9 Substrates with a Narrow Therapeutic IndexProducts: JAKAVI 5 MG TABLET, 14 ADET, JAKAVI 5 MG TABLET,TABLET, 14 ADET