Search
Midazolam
go.drugbank.com/drugs/DB00683ApprovedIllicitInvestigational[A257153] Midazolam is considered a schedule IV drug in the United States due to the low potential for abuse and low risk of dependence.[L5074] … [A173842] It belongs to a class of drugs called _benzodiazepines_. This drug is unique from others in this class due to its rapid onset of effects and short duration of action.
Categories: P-glycoprotein substrates, Cytochrome P-450 SubstratesProducts: Midazolam-hameln 2 mg/ml Injektions-/Infusionslösung, OZASED 2 mg/ml Lösung zum Einnehmen im EinzeldosisbehältnisAlpha-1-proteinase inhibitor
go.drugbank.com/drugs/DB00058ApprovedInvestigationalHuman alpha-1 proteinase inhibitor or alpha-1-antitrypsin, prepared from human plasma via Cohn alcohol fractionation followed by PEG and zinc chloride fractionation.
Synonyms: Alpha-1 MP, 122320-05-2Mixtures: Prolastin-C4,6-Dideoxy-4-{[4,5,6-Trihydroxy-3-(Hydroxymethyl)Cyclohex-2-En-1-Yl]Amino}-Alpha-D-Lyxo-Hexopyranosyl-(1->4)-Alpha-D-Threo-Hexopyranosyl-(1->6)-Alpha-L-Threo-Hexopyranose
go.drugbank.com/drugs/DB03495ExperimentalSynonyms: 4,6-Dideoxy-4-{[4,5,6-Trihydroxy-3-(Hydroxymethyl)Cyclohex-2-En-1-Yl]Amino}-Alpha-D-Lyxo-Hexopyranosyl-(1->4)-Alpha-D-Threo-Hexopyranosyl-(1->6)-Alpha-L-Threo-HexopyranoseDextrose, unspecified form
go.drugbank.com/drugs/DB09341ApprovedInvestigationalVet approvedL-glucose is a synthesized enantiomer that is used as a low-calorie sweetener and laxative. … Its aldohexose stereoisomer, dextrose or D-glucose, is the most commonly occurring isomer of glucose in nature.
Mixtures: ดี - 5 - 1/2 เอส, ดี - 5 - 1/2 เอสCategories: Compounds used in a research, industrial, or household settingIMT504
go.drugbank.com/drugs/DB17792InvestigationalIMT504, a non-CpG 24-mer oligodeoxynucleotide, is an immunomodulatory oligonucleotide currently being investigated as a rabies vaccine.[A259467]
Synonyms: DNA, D(P-THIO)(T-C-A-T-C-A-T-T-T-T-G-T-C-A-T-T-T-T-G-T-C-A-T-T), PyNTTTTGT class of oligodeoxynucleotide with a 24-base single chain composed of nucleotide sequence 5'TCATCATTTTGTCATTTTGTCATT 3'Gentian violet cation
go.drugbank.com/drugs/DB00406ApprovedA dye that is a mixture of violet rosanilinis with antibacterial, antifungal, and anthelmintic properties.
Mixtures: Kerr 100 Triple Dye Dispos-ASynonyms: Crystal violet(1+), Gentian violet(1+)Doxorubicin
go.drugbank.com/drugs/DB00997ApprovedInvestigationalDoxorubicin is a cytotoxic anthracycline antibiotic isolated from cultures of Streptomyces peucetius var. caesius along side with daunorubicin, another cytotoxic agent, in 1970. … [A1575,A257709,A257614] Although they both have aglyconic and sugar moieties, doxorubicin's side chain terminates with a primary alcohol group compared to the methyl group of daunorubicin.
Categories: P-glycoprotein substrates with a Narrow Therapeutic Index, Cytochrome P-450 CYP2D6 Substrates with a Narrow Therapeutic IndexSynonyms: (1S,3S)-3-glycoloyl-3,5,12-trihydroxy-10-methoxy-6,11-dioxo-1,2,3,4,6,11-hexahydrotetracen-1-yl 3-amino-2,3,6-trideoxy-α-L-lyxo-hexopyranoside, (8S-cis)-10-((3-amino-2,3,6-trideoxy-α-L-lyxo-hexopyranosyl)oxy)-7,8,9,10-tetrahydro-6,8,11-trihydroxy-8-(hydroxyacetyl)-1-methoxy-5,12-naphthacenedioneUpanovimab
go.drugbank.com/drugs/DB16505InvestigationalUpanovimab (SCTA01) was under investigation in clinical trials (NCT04683328, NCT04644185, NCT04709328 and NCT05156645) to evaluate its safety and efficacy in patients with severe COVID-19
Synonyms: IMMUNOGLOBULIN G1, ANTI-(SEVERE ACUTE RESPIRATORY SYNDROME CORONAVIRUS 2 SPIKE GLYCOPROTEIN) (HUMAN-MUS MUSCULUS MONOCLONAL SCTA01 .GAMMA.1-CHAIN), DISULFIDE WITH HUMAN-MUS MUSCULUS MONOCLONAL SCTA01 .Evexomostat
go.drugbank.com/drugs/DB19140InvestigationalEvexomostat is under investigation in clinical trial NCT05570253 (A Study of SDX-7320 in Combination With Eribulin for People With Breast Cancer).
Synonyms: Poly((n-(2-hydroxypropyl)methacrylamide)-co-(methacryloyl-gly-phe-leu-gly amide with o-((trans-4-aminocyclohexyl)carbamoyl)fumagillol)) (~0.91:0.09 x)JQ1
go.drugbank.com/drugs/DB17021ExperimentalFirst-in-class potent and selective inhibitor of the BRD4 signaling pathway.
Synonyms: (s)-(+)-tert-butyl 2-(4-(4-chlorophenyl)-2,3,9-trimethyl-6h-thieno(3,2-f)(1,2,4)triazolo(4,3-a)(1,4)diazepin-6-yl)acetate, Tert-butyl 2-((6s)-4-(4-chlorophenyl)-2,3,9-trimethyl-6h-thieno(3,2-f)(1,2,4)triazolo(4,3-a)(1,4)diazepin-6-yl)acetate