Search
Ornidazole
go.drugbank.com/drugs/DB13026InvestigationalOrnidazole has been used in trials studying the prevention of Elective Colorectal Surgery.
Mixtures: SIPROZONE 500 MG/500 MG FILM KAPLI TABLET,30 ADET, ORCIPOL 500 MG/500 MG FILM TABLET, 14 ADETCategories: Heterocyclic Compounds, 1-RingVirulizin
go.drugbank.com/drugs/DB17098InvestigationalSynonyms: Virulizin-2.gamma., Bos taurus bile extract (heat hydrolyzed; mw < 3000)Reveglucosidase alfa
go.drugbank.com/drugs/DB17665InvestigationalSynonyms: Des-(2-7)-human insulin-like growth factor ii fusion protein with glycyl-l-alanyl-l-prolyl-human lysosomal alpha-glucosidase (acid maltase, aglucosidase alfa) produced in chinese hamster ovary (cho) cellsPhentermine
go.drugbank.com/drugs/DB00191ApprovedIllicitInvestigationalPhentermine is a sympathomimetic amine anorectic agent and it was introduced in 1959 as part of an anti-obesity combination drug. … [A174376, T403] Later on, phentermine was approved alone and in combination with topiramate in 2012 as a new alternative that required lower doses of phentermine to obtain the desired effect.[A174373]
International brands: Obestin-30Categories: Cytochrome P-450 Substrates, Monoamine Oxidase A Inhibitors for interaction with Monoamine Oxidase A substratesHexetidine
go.drugbank.com/drugs/DB08958ApprovedWithdrawnA bactericidal and fungicidal antiseptic. It is used as a 0.1% mouthwash for local infections and oral hygiene.
Mixtures: Isozid - H farblos - alkoholische Lösung zur Hautdesinfektion, Isozid - H gefärbt - alkoholische Lösung zur HautdesinfektionCategories: Heterocyclic Compounds, 1-RingDihydrouridine
go.drugbank.com/drugs/DB17822ExperimentalSynonyms: 1-[(2R,3R,4S,5R)-3,4-dihydroxy-5-(hydroxymethyl)oxolan-2-yl]-1,3-diazinane-2,4-dione, 2,4(1h,3h)-pyrimidinedione, dihydro-1-.beta.-d-ribofuranosyl-Categories: Heterocyclic Compounds, 1-RingAlogliptin
go.drugbank.com/drugs/DB06203ApprovedInvestigationalAlogliptin is a selective, orally-bioavailable inhibitor of enzymatic activity of dipeptidyl peptidase-4 (DPP-4). … Chemically, alogliptin is prepared as a benzoate salt and exists predominantly as the R-enantiomer (>99%). It undergoes little or no chiral conversion in vivo to the (S)-enantiomer.
Mixtures: OSENI 25 MG/30 MG TABLETS, OSENI 25 MG/30 MG TABLETSCategories: Cytochrome P-450 Substrates, Cytochrome P-450 CYP3A SubstratesPutative 4-hydroxy-4-methyl-2-oxoglutarate aldolase
go.drugbank.com/bio_entities/BE0001689TargetMycobacterium tuberculosisCatalyzes the aldol cleavage of 4-hydroxy-4-methyl-2-oxoglutarate (HMG) into 2 molecules of pyruvate.
Polypeptides: Putative 4-hydroxy-4-methyl-2-oxoglutarate aldolaseFunction: 4-hydroxy-4-methyl-2-oxoglutarate aldolase activityPinaverium
go.drugbank.com/drugs/DB09090ApprovedInvestigationalPinaverium is a spasmolytic agent used for functional gastrointestinal disorders. It is a quaternary ammonium compound that acts as an atypical calcium antagonist to restore normal bowel function. … Although it is not a currently approved drug by the FDA, pinaverium is available in over 60 countries including Canada.
Mixtures: BROMUX D® 100/300 MG CÁPSULA., DUOTRYNE®Categories: Cytochrome P-450 Substrates, Heterocyclic Compounds, 1-RingIMT504
go.drugbank.com/drugs/DB17792InvestigationalIMT504, a non-CpG 24-mer oligodeoxynucleotide, is an immunomodulatory oligonucleotide currently being investigated as a rabies vaccine.[A259467]
Synonyms: DNA, D(P-THIO)(T-C-A-T-C-A-T-T-T-T-G-T-C-A-T-T-T-T-G-T-C-A-T-T), PyNTTTTGT class of oligodeoxynucleotide with a 24-base single chain composed of nucleotide sequence 5'TCATCATTTTGTCATTTTGTCATT 3'