Search
Benserazide
go.drugbank.com/drugs/DB12783ApprovedInvestigationalMoreover, the European Medcines Agency has conferred an orphan designation upon benseraside since 2015 for its potential to be used as a therapy for beta thalassaemia as well [F3]. … When levodopa is used by itself as a therapy for treating Parkinson's disease, its ubiquitous metabolism into dopamine is responsible for a resultant increase in the levels of circulating dopamine in the
Mixtures: LEVOBENS TEVA 100MG/25MG, LEVODOPA BENS -CT 100MG/25Tribulus terrestris fruit
go.drugbank.com/drugs/DB14305InvestigationalTribulus terrestris fruit is a plant/plant extract used in some OTC (over-the-counter) products. It is not an approved drug.
Synonyms: Bai Ji LiIMT504
go.drugbank.com/drugs/DB17792InvestigationalIMT504, a non-CpG 24-mer oligodeoxynucleotide, is an immunomodulatory oligonucleotide currently being investigated as a rabies vaccine.[A259467]
Synonyms: PyNTTTTGT class of oligodeoxynucleotide with a 24-base single chain composed of nucleotide sequence 5'TCATCATTTTGTCATTTTGTCATT 3'Gamolenic acid
go.drugbank.com/drugs/DB13854ApprovedWithdrawnGamolenic acid is produced minimally in the body as the delta 6-desaturase metabolite of [DB00132]. It is converted to [DB00154], a biosynthetic precursor of monoenoic prostaglandins such as PGE1. … It is an omega-6 polyunsaturated fatty acid (PUFA) also referred to as 18:3n-6; 6,9,12-octadecatrienoic acid; and cis-6, cis-9, cis-12- octadecatrienoic acid [F27].
Mixtures: PRIM E CAPSULE, Evening Primrose Oil Cap 500mg W Vit EDaclatasvir
go.drugbank.com/drugs/DB09102ApprovedInvestigationalWithdrawnAccording to 2017 American Association for the Study of Liver Diseases (AASLD), 60mg of daclatasvir is recommended with 400mg [DB08934] for genotype 1a/b patients with or without cirrhosis as second-line … It is marketed under the name DAKLINZA and is contained in daily oral tablets as the hydrochloride salt form .
Synonyms: BMS-790052Velpatasvir
go.drugbank.com/drugs/DB11613ApprovedInvestigationalSince June 2016, Velpatasvir has been available as a fixed dose combination product with [DB08934], as the commercially available product Epclusa. … Notably, velpatasvir has a significantly higher barrier to resistance than the first generation NS5A inhibitors, such as [DB09027] and [DB09102], making it a highly potent and reliable alternative for
Mixtures: EPCLUSA TABLET 400MG/100MG, Epclusa (sofosbuvir 400mg/ velpatasvir 100mg) Film-Coated TabletsAlcohol Dependency
go.drugbank.com/conditions/DBCOND0071586Glimepiride
go.drugbank.com/drugs/DB00222ApprovedInvestigationalIt is sometimes classified as a third-generation SU because it has larger substitutions than other second-generation SUs. … [A177703] Compared to other SUs, glimepiride was associated with a lower risk of developing hypoglycemia and weight gain in clinical trials [A177709] as well as fewer cardiovascular effects than other
Mixtures: AMARYL®M 2MG/1000MG, GLIMET 2mg/1000mg SUSTAINED RELEASE TABLETSLopinavir
go.drugbank.com/drugs/DB01601ApprovedInvestigational[A191757] Lopinavir was previously under investigation in combination with ritonavir for the treatment of COVID-19 caused by SARS-CoV-2.[L12012]
Mixtures: Kaletra Tablet 100mg/25mg, Kaletra 100mg/25mg Film-Coated Tablet