Search

Displaying results 1121 - 1130 of 10000 in total
  1. Pathway

    Nilotinib Inhibition of BCR-ABL Action Pathway

    smpdb.ca/view/SMP0031697
    Drug action

    Nilotinib is a tyrosine kinase inhibitor used to treat chronic myelogenous leukemia (CML), a cancer characterized by increased and unregulated growth of white blood cells in the bone marrow and the accumulation of these cells in the bloo...

    Drugs: Nilotinib
    Enzymes: S-phase kinase-associated protein 2
  2. Pathway

    Asciminib Inhibition of BCR-ABL

    smpdb.ca/view/SMP0126943
    Drug action

    Asciminib is an inhibitor of ABL/BCR-ABL1 tyrosine kinase for the treatment of patients with Philadelphia chromosome-positive CML, including those with the T315I mutation. Asciminib is an allosteric inhibitor of the BCR-ABL1 tyrosine kin...

    Drugs: Asciminib
    Enzymes: S-phase kinase-associated protein 2
  3. Drug

    IMT504

    go.drugbank.com/drugs/DB17792
    Investigational

    IMT504, a non-CpG 24-mer oligodeoxynucleotide, is an immunomodulatory oligonucleotide currently being investigated as a rabies vaccine.[A259467]

    Synonyms: DNA, D(P-THIO)(T-C-A-T-C-A-T-T-T-T-G-T-C-A-T-T-T-T-G-T-C-A-T-T), PyNTTTTGT class of oligodeoxynucleotide with a 24-base single chain composed of nucleotide sequence 5'TCATCATTTTGTCATTTTGTCATT 3'
  4. Drug

    Trabodenoson

    go.drugbank.com/drugs/DB13122
    Investigational

    Trabodenoson has been used in trials studying the treatment of Ocular Hypertension (OHT) and Primary Open-Angle Glaucoma (POAG).

    Categories: Adenosine A receptor agonists, Heterocyclic Compounds, 2-Ring
  5. Pathway

    Dimethylglycine Dehydrogenase Deficiency

    smpdb.ca/view/SMP0000484
    Disease

    Dimethylglycine dehydrogenase deficiency, also called DMGDH deficiency and dimethylglycinuria, is a rare inborn error of metabolism (IEM) and autosomal recessive disorder of glycine metabolism caused by a defective DMGDH gene. DMGDH code...

    Drugs: Pyridoxal phosphate · Tetrahydrofolic acid · Ademetionine · Pyruvic acid · Arginine · Adenosine phosphate +26 more
    Enzymes: Betaine--homocysteine S-methyltransferase 1
  6. Pathway

    Dasatinib Inhibition of BCR-ABL Action Pathway

    smpdb.ca/view/SMP0031696
    Drug action

    Dasatinib is a tyrosine kinase inhibitor used to treat chronic myelogenous leukemia (CML), a cancer characterized by increased and unregulated growth of white blood cells in the bone marrow and the accumulation of these cells in the bloo...

    Drugs: Dasatinib
    Enzymes: S-phase kinase-associated protein 2
  7. Pathway

    Bafetinib Inhibition of BCR-ABL Action Pathway

    smpdb.ca/view/SMP0031699
    Drug action

    Bafetinib is a tyrosine kinase inhibitor used to treat chronic myelogenous leukemia (CML), a cancer characterized by increased and unregulated growth of white blood cells in the bone marrow and the accumulation of these cells in the bloo...

    Drugs: Bafetinib
    Enzymes: S-phase kinase-associated protein 2
  8. Pathway

    Non-Ketotic Hyperglycinemia

    smpdb.ca/view/SMP0125580
    Disease

    Non Ketotic Hyperglycinemeia (Glycine encephalopathy; Glycine cleavage system deficiency; NKH) is caused by mutations in several genes in the mitochondrial glycine cleavage system. These include the genes encoding P protein (GLDC), T pro...

    Drugs: Pyridoxal phosphate · Tetrahydrofolic acid · Ademetionine · Pyruvic acid · Arginine · Adenosine phosphate +26 more
    Enzymes: Betaine--homocysteine S-methyltransferase 1
  9. Drug

    LTI-03

    go.drugbank.com/drugs/DB18491
    Investigational

    LTI-03 is a caveolin-1 Scaffolding Domain 7-Mer

    Synonyms: L-threonine, l-phenylalanyl-l-threonyl-l-threonyl-l-phenylalanyl-l-threonyl-l-valyl-
  10. Drug

    Setogepram

    go.drugbank.com/drugs/DB15447
    Investigational

    Setogepram is under investigation in clinical trial NCT03184584 (Open-Label Rollover Study of PBI 4050 in Subjects With Alström Syndrome).

    Synonyms: 2-(3-Pentylphenyl)acetic acid, 3-Pentylbenzenacetic acid