Search
Tolevamer
go.drugbank.com/drugs/DB01344ApprovedIt may be taken orally or by rectum, as an enema, and functions as a potassium-binding resin in the intestines. … Sodium polystyrene sulfonate is a medication used to treat abnormally high potassium levels.
Categories: Compounds used in a research, industrial, or household settingSynonyms: poly(styrene-4-sulfonic acid)Calcitriol
go.drugbank.com/drugs/DB00136ApprovedInvestigationalNutraceutical[DB00146] undergoes hydroxylation to form calcitriol via 1α-hydroxylase (CYP27B1) activity [A26353]. Calcitriol is considered to be the most potent metabolite of vitamin D in humans [A3366]. … It is produced in the body after series of conversion steps of 7-dehydrocholesterol from exposure to UV light. 7-dehydrocholesterol is converted to [DB00169] (vitamin D3) in the skin, which is then converted
Categories: Vitamin D and Analogues, Cytochrome P-450 SubstratesSynonyms: (1α,3β,5Z,7E)-9,10-secocholesta-5,7,10(19)-triene-1,3,25-triol, 1α,25(OH)2D3Nateglinide
go.drugbank.com/drugs/DB00731ApprovedIn addition to reducing postprandial and fasting blood glucose, meglitnides have been shown to decrease glycosylated hemoglobin (HbA1c) levels, which are reflective of the last 8-10 weeks of glucose control … Nateglinide is extensively metabolized in the liver and excreted in urine (83%) and feces (10%). The major metabolites possess less activity than the parent compound.
Mixtures: NATMET 120/1000 MG TEDAVI PAKETI, 90+90 ADET, NATMET 120/500 MG TEDAVI PAKETI, 90+90 ADETCategories: Cytochrome P-450 Substrates, Cytochrome P-450 CYP3A SubstratesIMT504
go.drugbank.com/drugs/DB17792InvestigationalIMT504, a non-CpG 24-mer oligodeoxynucleotide, is an immunomodulatory oligonucleotide currently being investigated as a rabies vaccine.[A259467]
Synonyms: DNA, D(P-THIO)(T-C-A-T-C-A-T-T-T-T-G-T-C-A-T-T-T-T-G-T-C-A-T-T), PyNTTTTGT class of oligodeoxynucleotide with a 24-base single chain composed of nucleotide sequence 5'TCATCATTTTGTCATTTTGTCATT 3'Terlipressin
go.drugbank.com/drugs/DB02638ApprovedInvestigationalTerlipressin is a synthetic analogue of vasopressin, which is an endogenous neurohormone that acts as a vasoconstrictor.[A2601] It is a prodrug of [lypressin], or lysine vasopressin. … [A2601, A2602, A2603, A2604, A2605] It was also studied in hepatorenal syndrome (HRS) and variceal bleeding.[A252672] The drug was first approved by the FDA in September 2022.[L43217]
Products: GLYPRESSIN 1 MG/8,5 ML IV ENJEKSIYONLUK COZELTI ICEREN AMPUL, 5 ADET, HAEMOPRESSIN® 1 MGCandesartan cilexetil
go.drugbank.com/drugs/DB00796ApprovedInvestigationalCandesartan lowers blood pressure by antagonizing the renin-angiotensin-aldosterone system (RAAS); it competes with angiotensin II for binding to the type-1 angiotensin II receptor (AT1) subtype and prevents … It may also be used as an alternative agent for the treatment of heart failure, systolic dysfunction, myocardial infarction and coronary artery disease.
Mixtures: CANDAM® H 5/16/12.5 MG, CANDAM® 5/16 MG TABLETASCategories: Heterocyclic Compounds, 1-Ring, Angiotensin 2 Receptor BlockerClozapine
go.drugbank.com/drugs/DB00363ApprovedInvestigational[A256713,A256718] However, continued evidence of its effectiveness led to clozapine's eventual reintroduction, although with a reluctance to prescribe it. … [A256708] Clozapine displays affinity to various neuroreceptors with a particularly low affinity to the dopamine receptors, thus breaking the mold of first-generation antipsychotics and deeming it "atypical
Categories: Adrenergic alpha-1 Receptor Antagonists, Serotonin 5-HT1 Receptor AntagonistsProducts: CLOZAPIN - CT 50 MG TABL, CLOZAPIN - CT 100 MG TABLBenzoyl peroxide
go.drugbank.com/drugs/DB09096ApprovedInvestigational[L33249,L33264,L33269,L33299,L33314] It has been formulated as products with either a single active ingredient,[L33249,L33299] or with [erythromycin],[L33264] [clindamycin],[L33269] or [adapalene]. … Benzoyl peroxide is a commonly used drug in topical treatments for acne.
Mixtures: OXIMIN 10 MG/G + 50 MG/G JEL,50 G, OXIMIN 10 MG/G + 50 MG/G JEL,25 GProducts: Let Me Be Perfectly Clear, TRİAKNE %10 EMÜLSİYON JEL, 50 GNandrolone decanoate
go.drugbank.com/drugs/DB08804ApprovedIllicitInvestigational[A233849] Nandrolone decanoate was granted FDA approval on 5 October 1962.[L32564] … [A233789,A233849,L32564,L9464] The process for creating esters of [nandrolone] was patented in Spain in 1959[L33244] and in 1960, it was described as having a long duration of action and strong anabolic
Categories: Monoamine Oxidase A Inhibitors for interaction with Monoamine Oxidase A substratesSynonyms: 19-nortestosterone decanoateDeferiprone
go.drugbank.com/drugs/DB08826ApprovedInvestigationalFDA approved on October 14, 2011. … Thalassemias are a type of hereditary anaemia due a defect in the production of hemoglobin. As a result, erythropoiesis, the production of new red blood cells, is impaired.
Categories: Heterocyclic Compounds, 1-Ring, Cytochrome P-450 SubstratesSynonyms: 3-Hydroxy-1,2-dimethyl-4(1H)-pyridone, 1,2-Dimethyl-3-hydroxypyrid-4-one