Search
Gabapentin
go.drugbank.com/drugs/DB00996ApprovedInvestigational[A14097,A186179] Gabapentin has some stark advantages as compared with other anti-epileptics, such as a relatively benign adverse effect profile, wide therapeutic index, and lack of appreciable metabolism … It is structurally and functionally related to another GABA derivative, [pregabalin].
Mixtures: Innoprax-5, Cyclo/Gaba 10/300 PackCategories: Gabapentin and Prodrugs, Amino Acids, Peptides, and ProteinsVecuronium
go.drugbank.com/drugs/DB01339ApprovedInvestigationalA non-depolarizing neuromuscular blocking agent with shorter duration of action than pancuronium. … Its lack of significant cardiovascular effects and lack of dependence on good kidney function for elimination as well as its short duration of action and easy reversibility provide advantages over, or
Categories: P-glycoprotein substratesProducts: NORCURON 10 MG, VECRON 10 MG İ.V. ENJEKSİYONLUK ÇÖZELTİ HAZIRLAMAK İÇİN LİYOFİLİZE TOZ VE ÇÖZÜCÜ, 1 FLAKON VE 1 AMPULPaliperidone
go.drugbank.com/drugs/DB01267ApprovedInvestigationalPaliperidone is also active as an antagonist at alpha 1 and alpha 2 adrenergic receptors and H1 histaminergic receptors, which may explain some of the other effects of the drug. … It has been proposed that the drug's therapeutic activity in schizophrenia is mediated through a combination of central dopamine Type 2 (D2) and serotonin Type 2 (5HT2A) receptor antagonism.
Categories: Adrenergic alpha-1 Receptor Antagonists, Heterocyclic Compounds, 1-RingSynonyms: 9-hydroxyrisperidoneRotenone
go.drugbank.com/drugs/DB11457ExperimentalVet approvedIt has broad spectrum insecticide and pesticide activity and is also toxic to fish.
Categories: Heterocyclic Compounds, 1-Ring, Heterocyclic Compounds, 2-RingSynonyms: 5'β-rotenone, [2R-(2α,6aα,12aα)]-1,2,12,12a-tetrahydro-8,9-dimethoxy-2-(1-methylethenyl)[1]benzopyrano[3,4-b]furo[2,3-H][1]benzopyran-6(6aH)-oneMepolizumab
go.drugbank.com/drugs/DB06612ApprovedInvestigationalEosinophils are involved in inflammatory immune responses, and prolonged hypereosinophilia (typically defined as absolute eosinophil levels of 1500/mm<sup>3</sup> or more) is associated with a spectrum … This indication was subsequently expanded to cover EGPA on December 12, 2017, and HES on September 25, 2020.[L16518]
Categories: Interleukin-5 Antagonist, Amino Acids, Peptides, and ProteinsProducts: NUCALA 100 MG/ML SC ENJEKSİYONLUK ÇÖZELTİ İÇEREN KULLANIMA HAZIR ENJEKTÖR, 1 ADET, NUCALA 100 MG SUBKUTAN ENJEKSİYONLUK ÇÖZELTİ İÇİN LİYOFİLİZE TOZ, 1 ADETEmicizumab
go.drugbank.com/drugs/DB13923ApprovedInvestigationalEmicizumab is a humanized recombinant monoclonal antibody that mimics the function of the coagulation Factor VIII and it has the capacity to bind simultaneously to activated Factor IX and Factor X. … Emicizumab was originated as an improved form of hBS23 and it was approved on November 16, 2017.[A31279, L1016] It was created by Chugai Pharmaceuticals Co.
Categories: Amino Acids, Peptides, and Proteins, Blood and Blood Forming OrgansProducts: HEMLİBRA 150 MG/ 1 ML S.C. ENJEKSİYONLUK ÇÖZELTİ, 1 ADET, HEMLİBRA 30 MG/ 1 ML S.C. ENJEKSİYONLUK ÇÖZELTİ , 1 ADETIMT504
go.drugbank.com/drugs/DB17792InvestigationalIMT504, a non-CpG 24-mer oligodeoxynucleotide, is an immunomodulatory oligonucleotide currently being investigated as a rabies vaccine.[A259467]
Categories: Nucleic Acids, Nucleotides, and NucleosidesSynonyms: DNA, D(P-THIO)(T-C-A-T-C-A-T-T-T-T-G-T-C-A-T-T-T-T-G-T-C-A-T-T), PyNTTTTGT class of oligodeoxynucleotide with a 24-base single chain composed of nucleotide sequence 5'TCATCATTTTGTCATTTTGTCATT 3'Tuberculin purified protein derivative
go.drugbank.com/drugs/DB11601ApprovedTuberculin Purified Protein Derivative (PPD) is a sterile aqueous solution of a purified protein fraction for intradermal administration as an aid in the diagnosis of tuberculosis. … The diagnostic test is commonly referred to as the Mantoux test which serves to minimize the risk of transmission of infection with *Mycobacterium tuberculosis* through early diagnosis and appropriate
Categories: Compounds used in a research, industrial, or household setting, Indicators and ReagentsProducts: BIOCINE TESTPPD 5-UI/ 01 ML, PPD TÜBERKÜLIN 5 TU/ 0.1 ML INTRADERMAL ENJEKSIYONLUK ÇÖZELTI IÇEREN FLAKON, 1 ADETFerrous fumarate
go.drugbank.com/drugs/DB14491ApprovedInvestigationalUsed in treatment of iron deficiency anemia.
Mixtures: Vitamin C 202,8 mg/0,8 mg/100 mg - Hartkapseln, IROZINC ŞURUP ,100 MLCategories: Diet, Food, and Nutrition, Blood and Blood Forming OrgansDapsone
go.drugbank.com/drugs/DB00250ApprovedInvestigationalA sulfone active against a wide range of bacteria but mainly employed for its actions against mycobacterium leprae. … (From Martindale, The Extra Pharmacopoeia, 30th ed, p157-8)
Mixtures: Dapsone 6% / Niacinamide 2% / Spironolactone 5%, Dapsone 8.5% / Niacinamide 2% / Spironolactone 5%Categories: dapsone and rifampicin, dapsone, rifampicin and clofazimine