Search
Tolvaptan
go.drugbank.com/drugs/DB06212ApprovedInvestigationalFDA approved on May 19, 2009. … Tolvaptan is used to treat low blood sodium levels (hyponatremia) associated with various conditions like congestive heart failure, cirrhosis, and syndrome of inappropriate antidiuretic hormones (SIADH
Categories: P-glycoprotein substrates with a Narrow Therapeutic Index, Cytochrome P-450 CYP3A4 Substrates with a Narrow Therapeutic IndexProducts: Jinarc 45 mg and Jinarc 15 mg Tablets, SAMSCA 15 MG TABLET, 10 ADETOctinoxate
go.drugbank.com/drugs/DB09496ApprovedInvestigationalOctinoxate is a cinnamate ester and common ingredient in sunscreen and other skin care products to minimize DNA photodamage. … It was originally developed in 1950's as an organic UV-B filter that absorbs UV-B rays from sun.
Synonyms: ethylhexyl p-methoxycinnamateMixtures: The Art of Shaving Daily Sunscreen Broad Spectrum SPF 15, MD Glam SPF 50Saxagliptin
go.drugbank.com/drugs/DB06335ApprovedInvestigationalSaxagliptin (rINN) is an orally active hypoglycemic (anti-diabetic drug) of the new dipeptidyl peptidase-4 (DPP-4) inhibitor class of drugs. FDA approved on July 31, 2009.
Synonyms: (1S,3S,5S)-2-((2S)-Amino(3-hydroxytricyclo(3.3.1.13,7)dec-1-yl)acetyl)-2-azabicyclo(3.1.0)hexane-3-carbonitrileMixtures: Qtern 5 mg/10 mg Film-Coated Tablets, QTERN 5 MG/10 MG FİLM KAPLI TABLET, 28 ADETRotenone
go.drugbank.com/drugs/DB11457ExperimentalVet approvedIt has broad spectrum insecticide and pesticide activity and is also toxic to fish.
Synonyms: 5'β-rotenone, [2R-(2α,6aα,12aα)]-1,2,12,12a-tetrahydro-8,9-dimethoxy-2-(1-methylethenyl)[1]benzopyrano[3,4-b]furo[2,3-H][1]benzopyran-6(6aH)-oneCategories: Heterocyclic Compounds, 1-Ring, Heterocyclic Compounds, 2-RingNeostigmine
go.drugbank.com/drugs/DB01400ApprovedInvestigationalVet approvedA cholinesterase inhibitor used in the treatment of myasthenia gravis and to reverse the effects of muscle relaxants such as gallamine and tubocurarine.
Synonyms: m-Trimethylammoniumphenyldimethylcarbamate, (m-Hydroxyphenyl)trimethylammonium dimethylcarbamateCategories: Antiglaucoma Preparations and MioticsIMT504
go.drugbank.com/drugs/DB17792InvestigationalIMT504, a non-CpG 24-mer oligodeoxynucleotide, is an immunomodulatory oligonucleotide currently being investigated as a rabies vaccine.[A259467]
Synonyms: DNA, D(P-THIO)(T-C-A-T-C-A-T-T-T-T-G-T-C-A-T-T-T-T-G-T-C-A-T-T), PyNTTTTGT class of oligodeoxynucleotide with a 24-base single chain composed of nucleotide sequence 5'TCATCATTTTGTCATTTTGTCATT 3'Categories: Nucleic Acids, Nucleotides, and NucleosidesCilazapril
go.drugbank.com/drugs/DB01340ApprovedInvestigationalIt is branded as Inhibace in Canada and other countries, Vascace and Dynorm in a number of European countries, among many other names. None of these varieties are available in the United States. … It is a prodrug that is hydrolyzed after absorption to its main metabolite cilazaprilat.
Mixtures: ACEPRIX PLUS 5 MG/12.5 MG FILM TABLET, 30 ADET, Inhibace plus 5 mg/12,5 mg - FilmtablettenCategories: Heterocyclic Compounds, 1-Ring, ACE Inhibitors and DiureticsSufentanil
go.drugbank.com/drugs/DB00708ApprovedInvestigationalSufentanil is an opioid analgesic that is used as an adjunct in anesthesia, in balanced anesthesia, and as a primary anesthetic agent. … (AcelRx), was approved on November 2, 2018 [L4717].
Synonyms: N-(4-(Methoxymethyl)-1-(2-(2-thienyl)ethyl)-4-piperidyl)propionanilide, N-(4-(Methoxymethyl)-1-(2-(2-thienyl)ethyl)-4-piperidinyl)-N-phenylpropanamideCategories: Heterocyclic Compounds, 1-Ring, Fentanyl and fentanyl analoguesLercanidipine
go.drugbank.com/drugs/DB00528ApprovedInvestigationalWithdrawnLercanidipine is a calcium channel blocker of the dihydropyridine class. It is sold under various commercial names including Zanidip.
Mixtures: ZANIPRESS 10 MG/10 MG FILM TABLET, 30 ADET, ZANIPRESS 10 MG/10 MG FILM TABLET, 90 ADETCategories: Heterocyclic Compounds, 1-Ring, valsartan and lercanidipineNitrendipine
go.drugbank.com/drugs/DB01054ApprovedWithdrawnNitrendipine is a calcium channel blocker with marked vasodilator action. … It is an effective antihypertensive agent and differs from other calcium channel blockers in that it does not reduce glomerular filtration rate and is mildly natriuretic, rather than sodium retentive.
Synonyms: 1,4-dihydro-2,6-dimethyl-4-(3-nitrophenyl)-3,5-pyridinedicarboxylic acid ethyl methyl esterMixtures: ENEAS® 10/20 MG COMPRIMIDOS, ENEAS® 10/20 MG COMPRIMIDOS