Search
Octinoxate
go.drugbank.com/drugs/DB09496ApprovedInvestigationalOctinoxate is a cinnamate ester and common ingredient in sunscreen and other skin care products to minimize DNA photodamage. … It was originally developed in 1950's as an organic UV-B filter that absorbs UV-B rays from sun.
Synonyms: ethylhexyl p-methoxycinnamateMixtures: The Art of Shaving Daily Sunscreen Broad Spectrum SPF 15, MD Glam SPF 50Nitrendipine
go.drugbank.com/drugs/DB01054ApprovedWithdrawnNitrendipine is a calcium channel blocker with marked vasodilator action. … It is an effective antihypertensive agent and differs from other calcium channel blockers in that it does not reduce glomerular filtration rate and is mildly natriuretic, rather than sodium retentive.
Mixtures: ENEAS® 10/20 MG COMPRIMIDOS, ENEAS® 10/20 MG COMPRIMIDOSCategories: Heterocyclic Compounds, 1-Ring, enalapril and nitrendipineIMT504
go.drugbank.com/drugs/DB17792InvestigationalIMT504, a non-CpG 24-mer oligodeoxynucleotide, is an immunomodulatory oligonucleotide currently being investigated as a rabies vaccine.[A259467]
Categories: Nucleic Acids, Nucleotides, and NucleosidesSynonyms: DNA, D(P-THIO)(T-C-A-T-C-A-T-T-T-T-G-T-C-A-T-T-T-T-G-T-C-A-T-T), PyNTTTTGT class of oligodeoxynucleotide with a 24-base single chain composed of nucleotide sequence 5'TCATCATTTTGTCATTTTGTCATT 3'Chloroprocaine
go.drugbank.com/drugs/DB01161ApprovedInvestigational[A252952] Chloroprocaine can be given as an injection, and is available in formulations with and without methylparaben as a preservative. … [L43402] The pharmacological profile of chloroprocaine is characterized by a short latency and duration, similar to the one observed with [lidocaine].
Synonyms: 2-(Diethylamino)ethyl 4-amino-2-chlorobenzoate, 4-amino-2-chlorobenzoic acid 2-(diethylamino)ethyl esterProducts: Ampres 10 mg/ml Injektionslösung, Ampres 20 mg/ml InjektionslösungPyridostigmine
go.drugbank.com/drugs/DB00545ApprovedInvestigational[A231009, A231014, L32413, L32418] Pyridostigmine was granted initial FDA approval on April 6, 1955, as an oral tablet. … Possible dose forms have been expanded to include extended-release tablets, syrups, and injections, marketed under various brand and generic names.[L32408, L32413]
Categories: Heterocyclic Compounds, 1-Ring, Cytochrome P-450 CYP3A InducersInternational brands: Kalymin NCandesartan cilexetil
go.drugbank.com/drugs/DB00796ApprovedInvestigationalCandesartan lowers blood pressure by antagonizing the renin-angiotensin-aldosterone system (RAAS); it competes with angiotensin II for binding to the type-1 angiotensin II receptor (AT1) subtype and prevents … Candesartan may be used to treat hypertension, isolated systolic hypertension, left ventricular hypertrophy and diabetic nephropathy.
Mixtures: CANDAM® H 5/16/12.5 MG, CANDAM® 5/16 MG TABLETASCategories: Heterocyclic Compounds, 1-Ring, Angiotensin II Antagonists and DiureticsInfliximab
go.drugbank.com/drugs/DB00065ApprovedInvestigationalInfliximab is a tumor necrosis factor (TNF-alpha or TNF-α) blocker and a chimeric monoclonal IgG1 antibody composed of human constant (75%) and murine variable (25%) regions [A31469]. … By binding to both the soluble subunit and the membrane-bound precursor of TNF-α [A106], infliximab disrupts the interaction of TNF-α with its receptors and may also cause lysis of cells that produce TNF-α
Categories: Amino Acids, Peptides, and Proteins, Antineoplastic and Immunomodulating AgentsSynonyms: IMMUNOGLOBULIN G (HUMAN-MOUSE MONOCLONAL CA2 HEAVY CHAIN ANTI-HUMAN TUMOR NECROSIS FACTOR), DISULFIDE WITH HUMAN-MOUSE MONOCLONAL CA2 LIGHT CHAIN, DIMERColistimethate
go.drugbank.com/drugs/DB01111ApprovedInvestigationalVet approvedColistimethate is an antibiotic that has been shown to have bactericidal activity against aerobic gram-negative microorganisms. Colistimethate is particularly indicated when the infection is caused by sensitive strains of Pseudomonas aer...
Categories: Amino Acids, Peptides, and ProteinsProducts: COLIJECT ® 150 MG / VIAL, KOLİSTİPOL 150 MG IM/IV ENJEKSİYON VE İNHALASYON İÇİN LİYOFİLİZE TOZ İÇEREN FLAKON, 1 FLAKON VE 1 AMPULFelbamate
go.drugbank.com/drugs/DB00949ApprovedAlternatively, it is used to treat partial and generalized seizures associated with Lennox-Gastaut syndrome in children. It has a weak inhibitory effect on GABA receptor binding sites. … In particular, in the adult patient population, it can be employed to treat partial seizures (with and without generalization).
Categories: Cytochrome P-450 Substrates, Cytochrome P-450 CYP3A InducersSynonyms: Carbamic acid 3-carbamoyloxy-2-phenyl-propyl ester, 2-phenyl-1,3-propanediol dicarbamateMirabegron
go.drugbank.com/drugs/DB08893ApprovedInvestigationalMirabegron is a sympathomimetic beta-3 adrenergic receptor agonist used to relax the smooth muscle of the bladder in the treatment of urinary frequency and incontinence. … Mirabegron has a comparatively favorable adverse effect profile as compared to other available treatment options, and its complementary mechanism to the antimuscarinics that came before it allows for its
Categories: Heterocyclic Compounds, 1-Ring, Genito Urinary System and Sex HormonesProducts: BETMIGA 50 MG UZATILMIŞ SALIMLI FILM TABLET , 10 TABLET, BETMIGA 25 MG UZATILMIŞ SALIMLI FILM TABLET , 10 TABLET