Search
Azilsartan medoxomil
go.drugbank.com/drugs/DB08822ApprovedInvestigationalIt is used to treat hypertension as monotherapy or in combination with other antihypertensive drugs. It is also available in a combination product with [chlorthalidone]. … It is a selective AT1 subtype angiotensin II receptor antagonist. Azilsartan medoxomil is a relatively recently-developed antihypertensive drug that was first approved by the FDA in February 2011.
Mixtures: EDARBYCLOR (TABLETS) 40 MG/12.5 MG, EDARBYCLOR (TABLETS) 40 MG/12.5 MGCategories: Angiotensin 2 Receptor Blocker, Heterocyclic Compounds, 1-RingSalmeterol
go.drugbank.com/drugs/DB00938ApprovedInvestigational[L11545,L11548,L11551,L11554,L11557] It has a longer duration of action than the short-acting beta-2 adrenergic receptor agonist, [salbutamol]. … Salmeterol is a long-acting beta-2 adrenergic receptor agonist drug that is currently prescribed for the treatment of asthma and chronic obstructive pulmonary disease COPD.
Mixtures: SALFLUTIN 50/100UG 60 ED, SALFLUTIN 50/250UG 60 EDCategories: Adrenergic beta-2 Receptor Agonists, Selective Beta 2-adrenergic AgonistsDifluprednate
go.drugbank.com/drugs/DB06781ApprovedInvestigationalDifluprednate is a topical corticosteroid indicated for the treatment of infammation and pain associated with ocular surgery. It is a butyrate ester of 6(α), 9(α)-difluoro prednisolone acetate. … It is indicated for treatment of endogenous anterior uveiti.
Categories: Cytochrome P-450 Substrates, Cytochrome P-450 CYP3A SubstratesProducts: DİFLUNAT POMAT, 20 G, EPITOPIC POMAT %0,05, 20 GNirsevimab
go.drugbank.com/drugs/DB16258ApprovedInvestigational[L44146] Nirsevimab was also approved by Health Canada on April 19, 2023 and by the FDA in July 17, 2023 for the same indication.[L46392,L47461] … [L44146] It binds to the prefusion conformation of the RSV F protein, a glycoprotein involved in the membrane fusion step of the viral entry process, and neutralizes several RSV A and B strains.
Categories: Respiratory Syncytial Virus Anti-F Protein Monoclonal AntibodySynonyms: Immunoglobulin g1-kappa, anti-(human respiratory syncytial virus fusion glycoprotein f0 (protein f))human monoclonal antibody.gamma.1 heavy chain (1-456) (human vh (homo sapiens ighv1-69*01(ighd)-ighj4, *01 (90.1%)) (8.8.19) (1-126) -homo sapiens ighg1*03Ozanimod
go.drugbank.com/drugs/DB12612ApprovedInvestigationalOzanimod is a once-daily sphingosine 1-phosphate receptor modulator for the treatment of relapsing Multiple Sclerosis (MS) and inflammatory bowel disease. … [A189336] In clinical trials, Ozanimod has been shown to be well-tolerated and has resulted in a higher decrease in the rate of MS relapses than with intramuscular [interferon beta-1a], a current standard
Mixtures: ZEPOSIA 7-Day Starter Pack, ZEPOSIA 7-Day Starter PackCategories: Heterocyclic Compounds, 1-Ring, Sphingosine 1-phosphate Receptor ModulatorIMT504
go.drugbank.com/drugs/DB17792InvestigationalIMT504, a non-CpG 24-mer oligodeoxynucleotide, is an immunomodulatory oligonucleotide currently being investigated as a rabies vaccine.[A259467]
Synonyms: DNA, D(P-THIO)(T-C-A-T-C-A-T-T-T-T-G-T-C-A-T-T-T-T-G-T-C-A-T-T), PyNTTTTGT class of oligodeoxynucleotide with a 24-base single chain composed of nucleotide sequence 5'TCATCATTTTGTCATTTTGTCATT 3'Marstacimab
go.drugbank.com/drugs/DB17725ApprovedInvestigationalMarstacimab is a human monoclonal immunoglobulin G Type 1 (IgG1) antibody produced by Chinese hamster ovary (CHO) cells by recombinant DNA technology. … [L51803] It is a tissue factor pathway inhibitor (TFPI) antagonist, which is an endogenous anticoagulant.
Synonyms: Immunoglobulin g1, anti-(human tissue factor pathway inhibitor) (human monoclonal pf-06741086 .gamma.1-chain), disulfide with human monoclonal pf-06741086 .lambda.-chain, dimerProducts: Hympavzi 150 mg/mL Enjeksiyonluk Çözelti İçeren Kullanıma Hazır Kalem (1 adet)Pentetic acid
go.drugbank.com/drugs/DB14007ApprovedInvestigational[A32501] It is currently considered, in all the dosage forms, as a member of the list of approved inactive ingredients for drug products by the FDA. … [L2242] DPTA was developed by the pharmaceutical company CIS US and FDA approved on April 14, 2004.[L1469]
Categories: Compounds used in a research, industrial, or household settingSynonyms: DTP-ARotenone
go.drugbank.com/drugs/DB11457ExperimentalVet approvedIt has broad spectrum insecticide and pesticide activity and is also toxic to fish.
Categories: Heterocyclic Compounds, 1-Ring, Heterocyclic Compounds, 2-RingSynonyms: [2R-(2α,6aα,12aα)]-1,2,12,12a-tetrahydro-8,9-dimethoxy-2-(1-methylethenyl)[1]benzopyrano[3,4-b]furo[2,3-H][1]benzopyran-6(6aH)-one, 5'β-rotenoneFedratinib
go.drugbank.com/drugs/DB12500ApprovedInvestigational[A183176,L8090] It is an anilinopyrimidine derivative.[A183188] Fedratinib was granted FDA approval on August 16, 2019.[L8090] … Fedratinib, also known as SAR302503 and TG101348, is a tyrosine kinase inhibitor used to treat intermediate-2 and high risk primary and secondary myelofibrosis.
Categories: MATE 2 Inhibitors, MATE 1 InhibitorsProducts: Inrebic 100 mg Sert Kapsül, 120 ADET, Inrebic 100 mg capsules