Search
9-(N-methyl-L-isoleucine)-cyclosporin A
go.drugbank.com/drugs/DB13068Investigational9-(N-methyl-L-isoleucine)-cyclosporin A (NIM811) has been used in trials studying the treatment of Chronic Hepatitis C Genotype-1 Relapse.
Rosomidnar
go.drugbank.com/drugs/DB17154InvestigationalSynonyms: (3'-5')d(c-a-c-g-c-a-c-g-c-g-c-a-t-c-c-c-c-g-c-c-c-g-t-g)Octrizole
go.drugbank.com/drugs/DB21133ExperimentalOctrizole is a small molecule drug. Octrizole has a monoisotopic molecular weight of 323.2 Da.
Synonyms: Bisoctrizole related compound aBesigomsin
go.drugbank.com/drugs/DB20894ExperimentalBesigomsin is a small molecule drug. Besigomsin has a monoisotopic molecular weight of 416.18 Da.
Categories: Compounds used in a research, industrial, or household setting, P-glycoprotein inhibitorsSynonyms: Gomisin a, (+)-gomisin aPancrelipase amylase
go.drugbank.com/drugs/DB11065ApprovedInvestigationalPancrelipase, in general, is composed of a mixture of pancreatic enzymes which include amylases, lipases, and proteases. These enzymes are extracted from porcine pancreatic glands. … [T177] The pancrelipase amylase is a single polypeptide chain containing two SH groups and four disulfide bridges.
Mixtures: KREON MIKRO 5000 IU MINIMIKROSFER,, Creon 8 CapSynonyms: Amylase A, Amylase ADBakuchiol
go.drugbank.com/drugs/DB16102InvestigationalBakuchiol is under investigation in clinical trial NCT03112863 (Comparison of the Cosmetic Effects of Bakuchiol and Retinol).
Synonyms: Sytenol a, (s)-bakuchiolIMT504
go.drugbank.com/drugs/DB17792InvestigationalIMT504, a non-CpG 24-mer oligodeoxynucleotide, is an immunomodulatory oligonucleotide currently being investigated as a rabies vaccine.[A259467]
Synonyms: DNA, D(P-THIO)(T-C-A-T-C-A-T-T-T-T-G-T-C-A-T-T-T-T-G-T-C-A-T-T), PyNTTTTGT class of oligodeoxynucleotide with a 24-base single chain composed of nucleotide sequence 5'TCATCATTTTGTCATTTTGTCATT 3'Interferon beta-1a
go.drugbank.com/drugs/DB00060ApprovedInvestigationalIt is produced by mammalian cells (Chinese Hamster Ovary cells) into which the human interferon beta gene has been introduced. … The amino acid sequence is identical to that of natural human interferon beta.
Categories: Interferon Type I, interferon beta-1aSynonyms: Interferon beta 1-a, IFN β-1aFollitropin
go.drugbank.com/drugs/DB00066ApprovedInvestigationalFollitropin beta is produced in genetically engineered Chinese hamster cell lines (CHO). … However, a more recent study showed there is may be a slight clinical difference, with the alpha form tending towards a higher pregnancy rate and the beta form tending towards a lower pregnancy rate, but
Mixtures: MENOPUR 150 IU IM VE SC ENJEKSIYON IÇIN TOZ IÇEREN FLAKON, 5 ADET, MENOPUR 150 IU IM VE SC ENJEKSIYON IÇIN TOZ IÇEREN FLAKON, 1 ADETSynonyms: FSH-a, FSH-bSelpercatinib
go.drugbank.com/drugs/DB15685ApprovedInvestigationalSelpercatinib is a kinase inhibitor with enhanced specificity for RET tyrosine kinase receptors (RTKs) over other RTK classes. … [A202055, A202052, L13604] Enhanced RET (Rearranged during transfection) oncogene expression is a hallmark of many cancers.
Categories: MATE 1 Inhibitors, P-glycoprotein inhibitorsSynonyms: 6-(2-hydroxy-2-methylpropoxy)-4-(6-(6-((6-methoxypyridin-3-yl)methyl)-3,6-diazabicyclo[3.1.1]heptan-3-yl)pyridin-3-yl)pyrazolo[1,5-a]pyridine-3-carbonitrile