Search
Prasugrel
go.drugbank.com/drugs/DB06209ApprovedInvestigationalSimilar to clopidogrel, prasugrel is a prodrug that requires enzymatic transformation in the liver to its active metabolite, R-138727. … Prasugrel, a thienopyridine derivative, is a platelet activation and aggregation inhibitor structurally and pharmacologically related to clopidogrel and ticlopidine.
Categories: Heterocyclic Compounds, 1-Ring, Cytochrome P-450 SubstratesProducts: PRASUGREL BETA 5 MG FTA, Prasulan 5 mg-FilmtablettenSotigalimab
go.drugbank.com/drugs/DB16413InvestigationalSotigalimab is under investigation in clinical trial NCT03123783 (CD40 Agonistic Antibody APX005M in Combination With Nivolumab).
Synonyms: IMMUNOGLOBULIN G1 (270-GLUTAMIC ACID, C-TERMINAL-LYSINE-CLIPPED), ANTI-(HUMAN CD40 ANTIGEN) (HUMAN-ORYCTOLAGUS CUNICULUS MONOCLONAL APX005M .GAMMA.1-CHAIN), DISULFIDE WITH HUMAN-ORYCTOLAGUS CUNICULUS MONOCLONALAdalimumab
go.drugbank.com/drugs/DB00051ApprovedInvestigationalIt is produced by recombinant DNA technology using a mammalian cell expression system. … A high-concentration, citrate-free formulation of Cyltezo® (adalimumab-adbm), a biosimilar to Humira®, was approved by the FDA in May 2024 for the treatment of multiple chronic inflammatory diseases.
International brands: Humira PenProducts: AMGEVITA 40 MG ILO I E PEN, AMGEVITA 40MG ILO I E PENPonsegromab
go.drugbank.com/drugs/DB18943InvestigationalPonsegromab is under investigation in clinical trial NCT05492500 (A Study of Ponsegromab in People With Heart Failure).
Synonyms: Immunoglobulin g1 (237-alanine,238-alanine,240-alanine), anti-(human growth differentiation factor 15) (human-mus musculus monoclonal pf-06946860 .gamma.1-chain), disulfide with human-mus musculus monoclonalIvonescimab
go.drugbank.com/drugs/DB18931InvestigationalIvonescimab is under investigation in clinical trial NCT05184712 (Phase 3 Clinical Study of AK112 for NSCLC Patients).
Synonyms: IMMUNOGLOBULIN G1 (240-ALANINE,241-ALANINE), ANTI-(HUMAN VASCULAR ENDOTHELIAL GROWTH FACTOR A) (HUMAN-MUS MUSCULUS MONOCLONAL AK112 .GAMMA.1-CHAIN) FUSION PROTEIN WITH PEPTIDE LINKER (GGGS)4 FUSION PROTEINIMT504
go.drugbank.com/drugs/DB17792InvestigationalIMT504, a non-CpG 24-mer oligodeoxynucleotide, is an immunomodulatory oligonucleotide currently being investigated as a rabies vaccine.[A259467]
Synonyms: DNA, D(P-THIO)(T-C-A-T-C-A-T-T-T-T-G-T-C-A-T-T-T-T-G-T-C-A-T-T), PyNTTTTGT class of oligodeoxynucleotide with a 24-base single chain composed of nucleotide sequence 5'TCATCATTTTGTCATTTTGTCATT 3'PR1 leukemia peptide vaccine
go.drugbank.com/drugs/DB15276InvestigationalPR1 leukemia peptide vaccine is under investigation in clinical trial NCT00513578 (Vaccine Therapy and GM-CSF in Treating Patients With Low-Risk or Intermediate-Risk Myelodysplastic Syndrome).
Synonyms: PR-1, L-VALINE, L-VALYL-L-LEUCYL-L-GLUTAMINYL-L-.ALPHA.-GLUTAMYL-L-LEUCYL-L-ASPARAGINYL-L-VALYL-L-THREONYL-Nabumetone
go.drugbank.com/drugs/DB00461Approved[A179077] While slightly reduced, possibly due to a degree of cyclooxygenase-2 selectivity (COX-2), nabumetone still produces significant adverse effects in the GI tract. … [label,A178903] The molecule itself is a pro-drug with its 6-methoxy-2-naphthylacetic acid (6-MNA) metabolite acting as a potent COX inhibitor similar in structure to [naproxen].
Mixtures: NuDroxiPAK N-500Categories: COX-2 Inhibitors, Cytochrome P-450 SubstratesSatralizumab
go.drugbank.com/drugs/DB15762ApprovedInvestigationaloccurs in a pH-dependent manner[A218551] - this allows satralizumab to bind an IL-6 receptor until it reaches an endosome, after which the drug may dissociate from the receptor and move back into the … Satralizumab is a recombinant humanized monoclonal antibody targeted against human interleukin-6 (IL-6) receptors, similar to [tocilizumab], which is produced in Chinese hamster ovary cells and based on
Synonyms: Humanised anti-IL-6 receptor monoclonal antibodyCategories: Interleukin-6 Receptor AntagonistPholcodine
go.drugbank.com/drugs/DB09209ApprovedIllicit[A31742] Pholcodine is not prescribed in the United States where it is classed as a Schedule I drug. It is categorized as Class B drug in the UK and officially taken out of the shelves in 2008. … Pholcodine formula is 3-o-morpholinoethylmorphine and it is classified as an antitussive which is defined as an opioid cough suppressant.
Mixtures: Rhynacol F SyrupCategories: Heterocyclic Compounds, 1-Ring, Heterocyclic Compounds with 4 or More Rings