30S ribosomal protein Thx

Details

Name
30S ribosomal protein Thx
Kind
protein
Synonyms
  • S31
Gene Name
rpsU
UniProtKB Entry
Q5SIH3Swiss-Prot
Organism
Thermus thermophilus (strain HB8 / ATCC 27634 / DSM 579)
NCBI Taxonomy ID
300852
Amino acid sequence
>lcl|BSEQ0019542|30S ribosomal protein Thx
MGKGDRRTRRGKIWRGTYGKYRPRKKK
Number of residues
27
Molecular Weight
3336.96
Theoretical pI
12.41
GO Classification
Functions
rRNA binding
Components
ribosome
General Function
Binds at the top of the head of the 30S subunit. It stabilizes a number of different RNA elements and thus is important for subunit structure.
Specific Function
rRNA binding
Pfam Domain Function
Signal Regions
Not Available
Transmembrane Regions
Not Available
Cellular Location
Not Available
Gene sequence
>lcl|BSEQ0019543|30S ribosomal protein Thx (rpsU)
ATGGGCAAGGGCGACCGCAGGACCCGGCGCGGCAAGATCTGGCGCGGCACCTACGGCAAG
TACCGGCCCCGGAAGAAGAAGTAG
Chromosome Location
Not Available
Locus
Not Available
External Identifiers
ResourceLink
UniProtKB IDQ5SIH3
UniProtKB Entry NameRSHX_THET8
GenBank Protein ID11125386
GenBank Gene IDAJ295159
PDB ID(s)1FJG, 1HNW, 1HNX, 1HNZ, 1HR0, 1I94, 1I95, 1I96, 1I97, 1IBK, 1IBL, 1IBM, 1J5E, 1JGO, 1JGP, 1JGQ, 1L1U, 1ML5, 1N32, 1N33, 1N34, 1N36, 1VVJ, 1VY4, 1VY5, 1VY6, 1VY7, 1XMO, 1XMQ, 1XNQ, 1XNR, 2E5L, 2HHH, 2UU9, 2UUA, 2UUB, 2UUC, 2UXB, 2UXC, 2UXD, 2VQE, 2VQF, 2ZM6, 3OTO, 3T1H, 3T1Y, 4AQY, 4B3M, 4B3R, 4B3S, 4B3T, 4DR1, 4DR2, 4DR3, 4DR4, 4DR5, 4DR6, 4DR7, 4DUY, 4DUZ, 4DV0, 4DV1, 4DV2, 4DV3, 4DV4, 4DV5, 4DV6, 4DV7, 4GKJ, 4GKK, 4JI0, 4JI1, 4JI2, 4JI3, 4JI4, 4JI5, 4JI6, 4JI7, 4JI8, 4JV5, 4JYA, 4K0K, 4KHP, 4L47, 4L71, 4LEL, 4LF4, 4LF5, 4LF6, 4LF7, 4LF8, 4LF9, 4LFA, 4LFB, 4LFC, 4LFZ, 4LNT, 4LSK, 4LT8, 4NXM, 4NXN, 4OX9, 4P6F, 4P70, 4TUA, 4TUB, 4TUC, 4TUD, 4TUE, 4V42, 4V4I, 4V4P, 4V4R, 4V4S, 4V4T, 4V4X, 4V4Y, 4V4Z, 4V51, 4V5A, 4V5C, 4V5D, 4V5E, 4V5F, 4V5G, 4V5J, 4V5K, 4V5L, 4V5M, 4V5N, 4V5P, 4V5Q, 4V5R, 4V5S, 4V68, 4V6A, 4V6F, 4V6G, 4V7J, 4V7K, 4V7L, 4V7M, 4V7W, 4V7X, 4V7Y, 4V7Z, 4V87, 4V8A, 4V8B, 4V8C, 4V8D, 4V8E, 4V8F, 4V8G, 4V8H, 4V8I, 4V8J, 4V8N, 4V8O, 4V8Q, 4V8U, 4V8X, 4V90, 4V95, 4V97, 4V9A, 4V9B, 4V9H, 4V9I, 4V9R, 4V9S, 4W2E, 4W2F, 4W2G, 4W2H, 4W2I, 4W4G, 4WPO, 4WQ1, 4WQF, 4WQR, 4WQU, 4WQY, 4WR6, 4WRA, 4WRO, 4WSD, 4WSM, 4WT1, 4WT8, 4WU1, 4WZD, 4WZO, 4X62, 4X64, 4X65, 4X66, 4Y4O, 4Y4P, 4YHH, 4YPB, 4YZV, 4Z3Q, 4Z3R, 4Z3S, 4Z8C, 4ZER, 5AA0, 5BR8, 5D8B
KEGG IDttj:TTHA1396
NCBI Gene ID3168745
General References
  1. Leontiadou F, Triantafillidou D, Choli-Papadopoulou T: On the characterization of the putative S20-thx operon of Thermus thermophilus. Biol Chem. 2001 Jul;382(7):1001-6. [Article]
  2. Choli T, Franceschi F, Yonath A, Wittmann-Liebold B: Isolation and characterization of a new ribosomal protein from the thermophilic eubacteria, Thermus thermophilus, T. aquaticus and T. flavus. Biol Chem Hoppe Seyler. 1993 Jun;374(6):377-83. [Article]
  3. Tsiboli P, Herfurth E, Choli T: Purification and characterization of the 30S ribosomal proteins from the bacterium Thermus thermophilus. Eur J Biochem. 1994 Nov 15;226(1):169-77. [Article]
  4. Suh MJ, Hamburg DM, Gregory ST, Dahlberg AE, Limbach PA: Extending ribosomal protein identifications to unsequenced bacterial strains using matrix-assisted laser desorption/ionization mass spectrometry. Proteomics. 2005 Dec;5(18):4818-31. [Article]
  5. Wimberly BT, Brodersen DE, Clemons WM Jr, Morgan-Warren RJ, Carter AP, Vonrhein C, Hartsch T, Ramakrishnan V: Structure of the 30S ribosomal subunit. Nature. 2000 Sep 21;407(6802):327-39. [Article]
  6. Brodersen DE, Clemons WM Jr, Carter AP, Morgan-Warren RJ, Wimberly BT, Ramakrishnan V: The structural basis for the action of the antibiotics tetracycline, pactamycin, and hygromycin B on the 30S ribosomal subunit. Cell. 2000 Dec 22;103(7):1143-54. [Article]
  7. Carter AP, Clemons WM, Brodersen DE, Morgan-Warren RJ, Wimberly BT, Ramakrishnan V: Functional insights from the structure of the 30S ribosomal subunit and its interactions with antibiotics. Nature. 2000 Sep 21;407(6802):340-8. [Article]
  8. Yusupova GZ, Yusupov MM, Cate JH, Noller HF: The path of messenger RNA through the ribosome. Cell. 2001 Jul 27;106(2):233-41. [Article]
  9. Pioletti M, Schlunzen F, Harms J, Zarivach R, Gluhmann M, Avila H, Bashan A, Bartels H, Auerbach T, Jacobi C, Hartsch T, Yonath A, Franceschi F: Crystal structures of complexes of the small ribosomal subunit with tetracycline, edeine and IF3. EMBO J. 2001 Apr 17;20(8):1829-39. [Article]
  10. Carter AP, Clemons WM Jr, Brodersen DE, Morgan-Warren RJ, Hartsch T, Wimberly BT, Ramakrishnan V: Crystal structure of an initiation factor bound to the 30S ribosomal subunit. Science. 2001 Jan 19;291(5503):498-501. [Article]
  11. Yusupov MM, Yusupova GZ, Baucom A, Lieberman K, Earnest TN, Cate JH, Noller HF: Crystal structure of the ribosome at 5.5 A resolution. Science. 2001 May 4;292(5518):883-96. Epub 2001 Mar 29. [Article]
  12. Ogle JM, Brodersen DE, Clemons WM Jr, Tarry MJ, Carter AP, Ramakrishnan V: Recognition of cognate transfer RNA by the 30S ribosomal subunit. Science. 2001 May 4;292(5518):897-902. [Article]
  13. Brodersen DE, Clemons WM Jr, Carter AP, Wimberly BT, Ramakrishnan V: Crystal structure of the 30 S ribosomal subunit from Thermus thermophilus: structure of the proteins and their interactions with 16 S RNA. J Mol Biol. 2002 Feb 22;316(3):725-68. [Article]

Associated Data

Drug Relations
DrugDrug groupPharmacological action?TypeActionsDetails
2-METHYLTHIO-N6-ISOPENTENYL-ADENOSINE-5'-MONOPHOSPHATEexperimentalunknowntargetDetails