Search
Parathyroid hormone
go.drugbank.com/drugs/DB05829ApprovedInvestigationalPreos is a registered trade mark owned by NPS Pharmaceuticals, Inc. The name Preos and the New Drug Application is pending approval by the U.S. Food and Drug Administration (FDA). … Parathyroid hormone (PTH) is a single-chain polypeptide composed of 84 amino acids.
Synonyms: PTH(1-84), rPTH(1-84)Simenepag isopropyl
go.drugbank.com/drugs/DB12977InvestigationalSimenepag isopropyl has been used in trials studying the treatment of Ocular Hypertension and Glaucoma, Open-Angle.
Taprenepag
go.drugbank.com/drugs/DB12623InvestigationalTaprenepag has been used in trials studying the treatment of Ocular Hypertension and Glaucoma, Open-Angle.
Categories: Receptors, Prostaglandin E, EP2 Subtype, agonistsEvodenoson
go.drugbank.com/drugs/DB12295InvestigationalEvodenoson has been used in trials studying the treatment of Open-angle Glaucoma and Ocular Hypertension.
Categories: Heterocyclic Compounds, 1-RingN4-Hydroxycytidine
go.drugbank.com/drugs/DB15660ExperimentalN4-Hydroxyctidine, or EIDD-1931, is a ribonucleoside analog which induces mutations in RNA virions. … [A193017] N4-hydroxycytodine has been shown to inhibit SARS-CoV-2 as well as other human and bat coronaviruses in mice and human airway epithelial cells.
Categories: Heterocyclic Compounds, 1-RingSynonyms: beta-D-N-4-Hydroxycytidine, 4-N-HydroxycytidineIMT504
go.drugbank.com/drugs/DB17792InvestigationalIMT504, a non-CpG 24-mer oligodeoxynucleotide, is an immunomodulatory oligonucleotide currently being investigated as a rabies vaccine.[A259467]
Synonyms: DNA, D(P-THIO)(T-C-A-T-C-A-T-T-T-T-G-T-C-A-T-T-T-T-G-T-C-A-T-T), PyNTTTTGT class of oligodeoxynucleotide with a 24-base single chain composed of nucleotide sequence 5'TCATCATTTTGTCATTTTGTCATT 3'Non-Ketotic Hyperglycinemia
smpdb.ca/view/SMP0000223DiseaseNon Ketotic Hyperglycinemeia (Glycine encephalopathy; Glycine cleavage system deficiency; NKH) is caused by mutations in several genes in the mitochondrial glycine cleavage system. These include the genes encoding P protein (GLDC), T pro...
Drugs: Pyridoxal phosphate · Tetrahydrofolic acid · Ademetionine · Pyruvic acid · Arginine · Adenosine phosphate +26 moreEnzymes: Betaine--homocysteine S-methyltransferase 13-Phosphoglycerate Dehydrogenase Deficiency
smpdb.ca/view/SMP0000721Disease3-Phosphoglycerate dehydrogenase deficiency is a disorder of L-serine biosynthesis that is characterized by congenital microcephaly, psychomotor retardation, and seizures.The disorder is caused by homozygous or compound heterozygous or h...
Drugs: Pyridoxal phosphate · Tetrahydrofolic acid · Ademetionine · Pyruvic acid · Arginine · Adenosine phosphate +26 moreEnzymes: Betaine--homocysteine S-methyltransferase 1Nilotinib Inhibition of BCR-ABL Action Pathway
smpdb.ca/view/SMP0031697Drug actionNilotinib is a tyrosine kinase inhibitor used to treat chronic myelogenous leukemia (CML), a cancer characterized by increased and unregulated growth of white blood cells in the bone marrow and the accumulation of these cells in the bloo...
Drugs: NilotinibEnzymes: S-phase kinase-associated protein 2