Search
Tramadol Metabolism Pathway
smpdb.ca/view/SMP0000637Drug metabolismTramadol (also named Ultram) is a class of opioid pain medication that used for treating pain. Metabolism of tramadol mainly happened in liver cell. … The O-demethylation of tramadol is catalyzed by the cytochrome CYP2D6 to form O-Desmethyltramadol, which further metabolized to O-Desmethyltramadol glucuronide through UDP-glucuronosyltransferase 2B7 and
IMT504
go.drugbank.com/drugs/DB17792InvestigationalIMT504, a non-CpG 24-mer oligodeoxynucleotide, is an immunomodulatory oligonucleotide currently being investigated as a rabies vaccine.[A259467]
Synonyms: PyNTTTTGT class of oligodeoxynucleotide with a 24-base single chain composed of nucleotide sequence 5'TCATCATTTTGTCATTTTGTCATT 3', DNA, D(P-THIO)(T-C-A-T-C-A-T-T-T-T-G-T-C-A-T-T-T-T-G-T-C-A-T-T)Estradiol
go.drugbank.com/drugs/DB00783ApprovedInvestigationalVet approvedBecause it has a low oral bioavailability on its own, estradiol is commonly formulated with an ester side-chain. … [DB00977] (EE) is a synthetic form of estradiol commonly used as the estrogenic component of most combination oral contraceptive pills (OCPs).
Synonyms: (17β)-estra-1,3,5(10)-triene-3,17-diol, 17β-estra-1,3,5(10)-triene-3,17-diolInternational brands: Estraderm MXAKV-9
go.drugbank.com/drugs/DB18061ExperimentalSynonyms: 5-((S)-1-(3,5-bis(trifluoromethyl)phenoxy)ethyl)-3-hydroxycyclohex-2-en-1-one, 1,3-Cyclohexanedione, 5-[(1S)-1-[3,5-bis(trifluoromethyl)phenoxy]ethyl]-Fluticasone propionate
go.drugbank.com/drugs/DB00588ApprovedInvestigationalFluticasone propionate was first approved in 1990[L5962].
Mixtures: SALFLUTIN 50/100UG 60 ED, SALFLUTIN 50/250UG 60 EDCategories: Cytochrome P-450 Substrates, Cytochrome P-450 CYP3A InhibitorsSalvia miltiorrhiza root
go.drugbank.com/drugs/DB14337InvestigationalSalvia miltiorrhiza root is a plant/plant extract used in some OTC (over-the-counter) products. It is not an approved drug.
Synonyms: Salviae Miltiorrhizae Radix Et RhizomaCategories: Herbs and Natural Products, Herbs (Hypotensive Properties)Dextrose, unspecified form
go.drugbank.com/drugs/DB09341ApprovedInvestigationalVet approvedIt is primarily stored as starch in plants and glycogen in animals to be used in various metabolic processes in the cellular level. … It is produced in humans via hepatic gluconeogenesis and breakdown of polymeric glucose forms (glycogenolysis).
Mixtures: SODIO60 MCG +POTASIO 20 MCG + CLORURO 50 MCG + CITRATO 30 MG + GLUCOSA111 MCG, CLORURO DE POTASIO 20 mEq EN DEXTROSA AL 5% Y CLORURO DE SODIO AL 0.45% BAXTERCategories: Compounds used in a research, industrial, or household settingLarsucosterol
go.drugbank.com/drugs/DB18079InvestigationalSynonyms: 25-hydroxycholest-5-en-3.beta.-yl hydrogen sulfate, Cholest-5-ene-3,25-diol, 3-(hydrogen sulfate), (3.beta.)-Zetomipzomib
go.drugbank.com/drugs/DB16070InvestigationalZetomipzomib is under investigation in clinical trial NCT04033926 (A Phase 2 Study of KZR-616 to Evaluate Safety and Efficacy in Patients With Active Polymyositis or Dermatomyositis).
Synonyms: (2S,3R)-N-[(2S)-3-(cyclopent-1-en-1-yl)-1-[(2R)-2-methyloxiran-2-yl]-1-oxopropan-2-yl]-3-hydroxy-3-(4-methoxyphenyl)-2-[(2S)-2-[2-(morpholin-4-yl)acetamido]propanamido]propanamidePanax notoginseng root
go.drugbank.com/drugs/DB14304InvestigationalPanax notoginseng root is a plant/plant extract used in some OTC (over-the-counter) products. It is not an approved drug.
Synonyms: Notoginseng Radix Et Rhizoma