Search
Levocetirizine
go.drugbank.com/drugs/DB06282ApprovedInvestigational[L7694] Levocetirizine has greater affinity for the histamine H<sub>1</sub> receptor than cetirizine.[L7694] Levocetirizine was granted FDA approval in 1995.[L7694] … Levocetirizine is a selective histamine H<sub>1</sub> antagonist used to treat a variety of allergic symptoms.[A181748,A181790,L7694] It is the R enantiomer of [cetirizine].
Mixtures: BROCRIPTIN® 10 MG/ 5 MG, LEPIXOS 5 MG/10 MG FILM TABLET ,30 ADETCategories: Cytochrome P-450 Substrates, Cytochrome P-450 CYP3A SubstratesIMT504
go.drugbank.com/drugs/DB17792InvestigationalIMT504, a non-CpG 24-mer oligodeoxynucleotide, is an immunomodulatory oligonucleotide currently being investigated as a rabies vaccine.[A259467]
Synonyms: DNA, D(P-THIO)(T-C-A-T-C-A-T-T-T-T-G-T-C-A-T-T-T-T-G-T-C-A-T-T), PyNTTTTGT class of oligodeoxynucleotide with a 24-base single chain composed of nucleotide sequence 5'TCATCATTTTGTCATTTTGTCATT 3'Clarithromycin
go.drugbank.com/drugs/DB01211ApprovedInvestigationalClarithromycin may be bacteriostatic or bactericidal depending on the organism and drug concentration. … Clarithromycin, a semisynthetic macrolide antibiotic derived from erythromycin, inhibits bacterial protein synthesis by binding to the bacterial 50S ribosomal subunit.
Mixtures: TRIO 1000 MG + 500 MG + 30 MG TEDAVİ PAKETİ, 6X7 ADET, TRIO 1000 MG + 500 MG + 30 MG TEDAVİ PAKETİ, 6X14 ADETCategories: P-glycoprotein inhibitors, P-glycoprotein substratesDopamine
go.drugbank.com/drugs/DB00988ApprovedInvestigationalDopamine is a major transmitter in the extrapyramidal system of the brain, and important in regulating movement. A family of receptors (receptors, dopamine) mediate its action. … One of the catecholamine neurotransmitters in the brain. It is derived from tyrosine and is the precursor to norepinephrine and epinephrine.
Mixtures: INYECCION DE CLORHIDRATO DE DOPAMINA EN DEXTROSA AL 5% USP (1600 MCG/ML), Dopamine HCl 3.2mg/ml Dextrose 5% Inj USPCategories: Compounds used in a research, industrial, or household setting, Monoamine Oxidase A SubstratesAlbuterol
go.drugbank.com/drugs/DB01001ApprovedInvestigationalVet approvedSalbutamol (Albuterol [USAN]) is a short-acting, selective beta2-adrenergic receptor agonist used in the treatment of asthma and COPD. … Salbutamol is formulated as a racemic mixture of the R- and S-isomers.
Mixtures: SALBUTAMOLO E IPRATROPIO BROMURO EG, Ibicar S (Salbutamol 100 mcg/actuation and Beclometasone 50 mcg/actuation) Pressurised InhalationCategories: Adrenergic beta-2 Receptor Agonists, Cytochrome P-450 CYP3A InhibitorsBisacodyl
go.drugbank.com/drugs/DB09020ApprovedInvestigational[A233290,A233300,A207700] Bisacodyl was patented on 25 September 1956[L33045] but has been used as a laxative since 1952.[A233300] … Bisacodyl, a diphenylmethane derivative, is a commonly used over the counter stimulant laxative for occasional constipation.
Mixtures: BEKUNIS 3 MG/5 MG KAPLI TABLET, 30 ADET, Dyrax-Q TabSynonyms: Phenol, 4,4'-(2-pyridinylmethylene)bis-, diacetate (ester)Chlorpheniramine
go.drugbank.com/drugs/DB01114ApprovedInvestigationalA histamine H1 antagonist used in allergic reactions, hay fever, rhinitis, urticaria, and asthma. It has also been used in veterinary applications.
Mixtures: COUGH - EN, PİRETİKOL PLUS 160 MG/5 ML+1 MG/5 ML+2.5 MG/5 ML PEDİATRİK ŞURUP, 100 MLCategories: Cytochrome P-450 Substrates, Heterocyclic Compounds, 1-RingFolic acid
go.drugbank.com/drugs/DB00158ApprovedInvestigationalNutraceuticalVet approvedAs a result, supplementation with 1-5mg of folic acid is recommended to prevent deficiency and a number of side effects associated with MTX therapy including mouth ulcers and gastrointestinal irritation … Folic acid, also known as folate or Vitamin B9, is a member of the B vitamin family and an essential cofactor for enzymes involved in DNA and RNA synthesis.
Mixtures: Vitamin C 202,8 mg/0,8 mg/100 mg - Hartkapseln, FERLOS 100 MG/0.35 MG TABLET, 30 ADETCategories: Vitamin B Complex, Heterocyclic Compounds, 2-RingLinagliptin
go.drugbank.com/drugs/DB08882ApprovedInvestigationalLinagliptin was approved by the FDA on May 2, 2011[L9557]. … Linagliptin differs from other DPP-4 inhibitors in that it has a non-linear pharmacokinetic profile, is not primarily eliminated by the renal system, and obeys concentration dependant protein binding[A37050
Mixtures: GLYXAMBI® 25 MG/ 5 MG, GLYXAMBI® 10 MG/ 5 MGCategories: Drugs Used in Diabetes, P-glycoprotein inhibitorsMLN3897
go.drugbank.com/drugs/DB06505ExperimentalMLN3897, a novel CCR1 inhibitor, disrupts osteoclast formation and blocks the interaction between multiple myeloma cells and osteoclasts.
Categories: Heterocyclic Compounds, 1-Ring, Heterocyclic Compounds, 2-RingSynonyms: BENZOXEPINO(3,4-B)PYRIDINE-7-METHANOL, 5-(3-((4S)-4-(4-CHLOROPHENYL)-4-HYDROXY-3,3-DIMETHYL-1-PIPERIDINYL)PROPYLIDENE)-5,11-DIHYDRO-.ALPHA.,.ALPHA.-DIMETHYL-, (4S)-4-(4-CHLOROPHENYL)-1-((3E)-3-(9-(1-HYDROXY-1-METHYL-ETHYL)-5H-(1)BENZOXEPINO(3,4-B)PYRIDIN-11-YLIDENE)PROPYL)-3,3-DIMETHYL-PIPERIDIN-4-OL