Search
Dextrose, unspecified form
go.drugbank.com/drugs/DB09341ApprovedInvestigationalVet approvedL-glucose is a synthesized enantiomer that is used as a low-calorie sweetener and laxative. … Its aldohexose stereoisomer, dextrose or D-glucose, is the most commonly occurring isomer of glucose in nature.
Mixtures: ดี - 5 - 1/2 เอส, ดี - 5 - 1/2 เอสCategories: Compounds used in a research, industrial, or household settingVAD-044
go.drugbank.com/drugs/DB17697InvestigationalVAD-044 is an allosteric AKT inhibitor developed by Vaderis Therapeutics AG. It is being investigated for the treatment of Hereditary Hemorrhagic Telangiectasia.[L46098]
Synonyms: 6-(4-((1S,3S)-1-amino-3-hydroxycyclobutyl)phenyl)-1-ethyl-7-phenyl-1H-pyrido[2,3-b][1,4]oxazin-2(3H)-oneRP-72
go.drugbank.com/drugs/DB17156InvestigationalSynonyms: CXC chemokine receptor types 1 and 2 inhibitor RP72, 72 amino acid proprietary recombinant protein antagonist for the CXCR1 and CXCR2 receptors of interleukin-8Sotevtamab
go.drugbank.com/drugs/DB19120InvestigationalSotevtamab is under investigation in clinical trial NCT06225843 (Sotevtamab (AB-16B5) Combined With FOLFOX as Neoadjuvant Treatment Prior to Resection of Colorectal Cancer Liver Metastasis).
Synonyms: Immunoglobulin g2, anti-(human clusterin .beta.-chain) (human-mus musculus monoclonal ab-16b5 .gamma.2-chain), disulfide with human-mus musculus monoclonal ab-16b5 .kappa.-chain, dimerDoxorubicin
go.drugbank.com/drugs/DB00997ApprovedInvestigationalDoxorubicin is a cytotoxic anthracycline antibiotic isolated from cultures of Streptomyces peucetius var. caesius along side with daunorubicin, another cytotoxic agent, in 1970. … [A1575,A257709,A257614] Although they both have aglyconic and sugar moieties, doxorubicin's side chain terminates with a primary alcohol group compared to the methyl group of daunorubicin.
Synonyms: (1S,3S)-3-glycoloyl-3,5,12-trihydroxy-10-methoxy-6,11-dioxo-1,2,3,4,6,11-hexahydrotetracen-1-yl 3-amino-2,3,6-trideoxy-α-L-lyxo-hexopyranoside, (8S-cis)-10-((3-amino-2,3,6-trideoxy-α-L-lyxo-hexopyranosyl)oxy)-7,8,9,10-tetrahydro-6,8,11-trihydroxy-8-(hydroxyacetyl)-1-methoxy-5,12-naphthacenedioneCategories: P-glycoprotein substrates with a Narrow Therapeutic Index, Cytochrome P-450 CYP2D6 Substrates with a Narrow Therapeutic IndexFluorescein
go.drugbank.com/drugs/DB00693ApprovedInvestigationalA phthalic indicator dye that appears yellow-green in normal tear film and bright green in a more alkaline medium, such as the aqueous humor, and is used therapeutically as a diagnostic aid in corneal
Synonyms: D&C Yellow No. 7, D and C Yellow No. 7Categories: Heterocyclic Compounds, 3-Ring, Compounds used in a research, industrial, or household settingAlprostadil
go.drugbank.com/drugs/DB00770ApprovedInvestigationalAlprostadil is a chemically-identical synthetic form of prostaglandin E1 (PGE1), a potent vasodilator produced endogenously. … [A257068,A257088] Alprostadil is also used in neonatal patients with congenital heart defects that depend on a patent ductus for survival until corrective or palliative surgery can be performed.
Synonyms: PGE-1, (11α,13E,15S)-11,15-dihydroxy-9-oxoprost-13-en-1-oic acidInternational brands: Caverject DCTreprostinil
go.drugbank.com/drugs/DB00374ApprovedInvestigationalHowever, the use of epoprostenol is limited due to its short half-life (3-5 min) and instability at room temperature. … [L41855,L41860] The first agent approved for the treatment of PAH was [epoprostenol], a synthetic prostacyclin that significantly increases patients' quality of life.
Categories: Prostaglandins I, Cytochrome P-450 SubstratesProducts: TREPROSTINIL DR. REDDY'S, REMODULIN 5 mg/ml InfusionslösungIMT504
go.drugbank.com/drugs/DB17792InvestigationalIMT504, a non-CpG 24-mer oligodeoxynucleotide, is an immunomodulatory oligonucleotide currently being investigated as a rabies vaccine.[A259467]
Synonyms: DNA, D(P-THIO)(T-C-A-T-C-A-T-T-T-T-G-T-C-A-T-T-T-T-G-T-C-A-T-T), PyNTTTTGT class of oligodeoxynucleotide with a 24-base single chain composed of nucleotide sequence 5'TCATCATTTTGTCATTTTGTCATT 3'Benzoyl peroxide
go.drugbank.com/drugs/DB09096ApprovedInvestigationalBenzoyl peroxide is a commonly used drug in topical treatments for acne. … [L33249,L33264,L33269,L33299,L33314] It has been formulated as products with either a single active ingredient,[L33249,L33299] or with [erythromycin],[L33264] [clindamycin],[L33269] or [adapalene].
Mixtures: OXIMIN 10 MG/G + 50 MG/G JEL,25 G, OXIMIN 10 MG/G + 50 MG/G JEL,50 GSynonyms: Peróxido de benzoilo