Search
Trimethobenzamide
go.drugbank.com/drugs/DB00662ApprovedInvestigationalTrimethobenzamide is a novel antiemetic which prevents nausea and vomiting in humans. Its actions are unclear but most likely involves the chemoreceptor trigger zone (CTZ). … In dogs pretreated with trimethobenzamide HCl, the emetic response to apomorphine is inhibited, while little or no protection is afforded against emesis induced by intragastric copper sulfate.
Mixtures: EMEDUR 100 MG/20 MG SUPOZİTUAR, 5 ADET, EMEDUR 200 MG SUPOZITUAR, 5 ADETSynonyms: N-[[4-(2-dimethylaminoethoxy)phenyl]methyl]-3,4,5-trimethoxybenzamideIsatuximab
go.drugbank.com/drugs/DB14811ApprovedInvestigationalIsatuximab (formerly SAR650984) is a humanized, IgG1-derived monoclonal antibody (mAb) produced from a Chinese hamster ovary (CHO) cell line. … [L12099] It is a cytolytic antibody targeted against CD38, a glycoprotein found on the surface of some immune cells that is highly expressed by malignant plasma cells in multiple myeloma.
Products: SARCLİSA 100 MG/5 ML IV İNFÜZYONLUK ÇÖZELTİ HAZIRLAMAK İÇİN KONSANTRE, 1 ADET, SARCLİSA 500 MG/25 ML IV İNFÜZYONLUK ÇÖZELTİ HAZIRLAMAK İÇİN KONSANTRE, 1 ADETMivacurium
go.drugbank.com/drugs/DB01226ApprovedWithdrawnIt binds competitively to cholinergic receptors on the motor end-plate to antagonize the action of acetylcholine, resulting in a block of neuromuscular transmission. … Mivacurium is a bisbenzylisoquinolinium based neuromuscular blocker or muscle relaxant.
Categories: Heterocyclic Compounds, 2-RingProducts: MİVACRON 10 MG/5 ML ENJEKSİYONLUK ÇÖZELTİ, 5 ADET, MIVACRON INJECTION 10 mg/5 mlRotenone
go.drugbank.com/drugs/DB11457ExperimentalVet approvedRotenone is an isoflavone compound that naturally occurs in the jicama vine plant as well as many Fabaceae plants. It has broad spectrum insecticide and pesticide activity and is also toxic to fish.
Categories: Compounds used in a research, industrial, or household setting, Heterocyclic Compounds, 1-RingSynonyms: 5'β-rotenone, [2R-(2α,6aα,12aα)]-1,2,12,12a-tetrahydro-8,9-dimethoxy-2-(1-methylethenyl)[1]benzopyrano[3,4-b]furo[2,3-H][1]benzopyran-6(6aH)-oneNitroprusside
go.drugbank.com/drugs/DB00325ApprovedInvestigationalNitroprusside is often administered intravenously to patients who are experiencing a hypertensive emergency. … Nitroprusside serves as a source of nitric oxide, a potent peripheral vasodilator that affects both arterioles and venules (venules more than arterioles).
Categories: Compounds used in a research, industrial, or household setting, Arteriolar Smooth Muscle, Agents Acting OnProducts: Sodium Nitroprusside In 0.9% Sodium Chloride, NITROPRUSIATO DE SODIO 50 MG/2 ML INYECTABLEHomocystinuria-Megaloblastic Anemia Due to Defect in Cobalamin Metabolism, cblG Complementation Type
smpdb.ca/view/SMP0000570DiseaseThis enzyme is responsible for forming L-methionine and tetrahydrofolic acid from homocysteine and 5-methyltetrahydrofolic acid. … Methionine synthase deficiency is characterized by an increase in homocysteine levels in the body and excreted in the urine, as well as decreased levels of methionine in the blood.
Drugs: Pyridoxal phosphate · Tetrahydrofolic acid · Ademetionine · Choline · Adenosine phosphate · Serine +17 moreEnzymes: S-methyl-5'-thioadenosine phosphorylaseThiamine
go.drugbank.com/drugs/DB00152ApprovedInvestigationalNutraceuticalVet approvedThiamine or thiamin, also known as vitamin B1, is a colorless compound with the chemical formula C12H17N4OS. It is soluble in water and insoluble in alcohol. Thiamine decomposes if heated. … Thiamine plays a key role in intracellular glucose metabolism and it is thought that thiamine inhibits the effect of glucose and insulin on arterial smooth muscle cell proliferation.
Synonyms: thiamine(1+) ion, Vitamin B 1International brands: Betalin SMetoprolol
go.drugbank.com/drugs/DB00264ApprovedInvestigational[A175162] Metoprolol was developed since 1969 by US Pharmaceutical Holdings I and FDA approved in 1978.[L5527] … Metoprolol is a selective beta-1 blocker commonly employed as the succinate and tartrate derivatives depending if the formulation is designed to be of immediate release or extended release.
Synonyms: 1-(isopropylamino)-3-[4-(2-methoxyethyl)phenoxy]propan-2-olMixtures: Implicor 50 mg/5 mg Filmtabletten, IMPLICOR FILM-COATED TABLET 50 mg/5 mgTacrolimus
go.drugbank.com/drugs/DB00864ApprovedInvestigationalIt is also used in a topical preparation in the treatment of severe atopic dermatitis, severe refractory uveitis after bone marrow transplants, and the skin condition vitiligo. … It was discovered in 1984 from the fermentation broth of a Japanese soil sample that contained the bacteria Streptomyces tsukubaensis. Tacrolimus is chemically known as a macrolide.
Mixtures: Hyaluronic Acid Sodium Salt 1% / Niacinamide 4% / Tacrolimus 0.1%, Niacinamide 4% / Tacrolimus 0.1%Categories: P-glycoprotein substrates with a Narrow Therapeutic Index, Cytochrome P-450 CYP3A4 Substrates with a Narrow Therapeutic IndexIMT504
go.drugbank.com/drugs/DB17792InvestigationalIMT504, a non-CpG 24-mer oligodeoxynucleotide, is an immunomodulatory oligonucleotide currently being investigated as a rabies vaccine.[A259467]
Synonyms: DNA, D(P-THIO)(T-C-A-T-C-A-T-T-T-T-G-T-C-A-T-T-T-T-G-T-C-A-T-T), PyNTTTTGT class of oligodeoxynucleotide with a 24-base single chain composed of nucleotide sequence 5'TCATCATTTTGTCATTTTGTCATT 3'