Search
IMT504
go.drugbank.com/drugs/DB17792InvestigationalIMT504, a non-CpG 24-mer oligodeoxynucleotide, is an immunomodulatory oligonucleotide currently being investigated as a rabies vaccine.[A259467]
Synonyms: DNA, D(P-THIO)(T-C-A-T-C-A-T-T-T-T-G-T-C-A-T-T-T-T-G-T-C-A-T-T), PyNTTTTGT class of oligodeoxynucleotide with a 24-base single chain composed of nucleotide sequence 5'TCATCATTTTGTCATTTTGTCATT 3'Ibuprofen
go.drugbank.com/drugs/DB01050ApprovedInvestigationalIn particular, it is generally proposed that the S-enantiomer is capable of eliciting stronger pharmacological activity than the R-enantiomer.[A39194] … [A39074] The formula of ibuprofen is 2-(4-isobutylphenyl) propionic acid and its initial development was in 1960 while researching for a safer alternative for aspirin.
Synonyms: (±)-α-methyl-4-(2-methylpropyl)benzeneacetic acid, (±)-2-(p-isobutylphenyl)propionic acidInternational brands: Act-3, Alges-XHomocystinuria-Megaloblastic Anemia Due to Defect in Cobalamin Metabolism, cblG Complementation Type
smpdb.ca/view/SMP0125684DiseaseThis enzyme is responsible for forming L-methionine and tetrahydrofolic acid from homocysteine and 5-methyltetrahydrofolic acid. … Methionine synthase deficiency is characterized by an increase in homocysteine levels in the body and excreted in the urine, as well as decreased levels of methionine in the blood.
Drugs: Pyridoxal phosphate · Tetrahydrofolic acid · Ademetionine · Choline · Adenosine phosphate · Serine +17 moreEnzymes: S-methyl-5'-thioadenosine phosphorylaseLong-Chain-3-Hydroxyacyl-CoA Dehydrogenase Deficiency (Fatty Acid Elongation in Mitochondria)
smpdb.ca/view/SMP0125748DiseaseThe estimated birth prevalence of LCHADD is 1 in 62 000 in Northern European individuals. The worldwide birth prevalence is estimated at 1 in 250 000. … MCADD is an autosomal recessive disorder associated with a mutation in the enzyme known as hydroxyacyl-CoA dehydrogenase (HADHA).
Benzatropine
go.drugbank.com/drugs/DB00245ApprovedInvestigationalThe generation of structure-activity relationships proved that benztropine derivatives with the presence of a chlorine substituent in the para position in one of the phenyl rings produces an increased … It is a combination molecule between a tropane ring, similar to cocaine, and a diphenyl ether from the dialkylpiperazines determined to be a dopamine uptake inhibitor since 1970.
Categories: Cytochrome P-450 Substrates, Cytochrome P-450 CYP2D6 SubstratesSynonyms: benzhydryl 8-methyl-8-azabicyclo[3.2.1]oct-3-yl ether, 3α-benzhydryloxy-8-methyl-8-azabicyclo[3.2.1]octaneCisplatin
go.drugbank.com/drugs/DB00515ApprovedInvestigationalCisplatin, cisplatinum or cis-diamminedichloroplatinum(II) (CDDP) is a platinum-based chemotherapy drug used to treat various types of cancers, including sarcomas, some carcinomas (e.g. small cell lung … It was the first member of its class, which now also includes carboplatin and oxaliplatin.
Categories: Compounds used in a research, industrial, or household setting, Cytochrome P-450 CYP2B6 InhibitorsSynonyms: INT-230-6 COMPONENT CISPLATIN, CIS-DIAMMINEDICHLOROPLATINUM IIExenatide
go.drugbank.com/drugs/DB01276ApprovedInvestigationalExenatide is a glucagon-like peptide-1 (GLP-1) analog[L42690]. … [L42685,L42690] Bydureon, the brand name product of extended-release exenatide in an injectable suspension, was discontinued in 2021.
Categories: Drugs Used in Diabetes, Glucagon-like peptide-1 (GLP-1) analoguesSynonyms: Exendin 4, Exendin-4Ceftriaxone
go.drugbank.com/drugs/DB01212ApprovedInvestigationalCeftriaxone is a broad-spectrum third-generation cephalosporin antibiotic. … [A215582] It has a very long half-life compared to other cephalosporins and is high penetrable into the meninges[A215582], eyes[A215647], and inner ear[A215627].
Mixtures: CEFTRIAXONA 1000 MG + SULBACTAM 500 MG, CEF-3 INJECTION IM (1G)Categories: P-glycoprotein inhibitors, Heterocyclic Compounds, 2-RingParicalcitol
go.drugbank.com/drugs/DB00910ApprovedInvestigationalParicalcitol is a synthetic vitamin D analog. Paricalcitol has been used to reduce parathyroid hormone levels. … Paricalcitol is indicated for the prevention and treatment of secondary hyperparathyroidism associated with chronic renal failure.
Categories: Vitamin D and Analogues, Cytochrome P-450 SubstratesSynonyms: 19-Nor-1alpha,25-dihydroxyvitamin D2Digoxin
go.drugbank.com/drugs/DB00390ApprovedInvestigational[A178234] Digoxin is classified as a cardiac glycoside and was initially approved by the FDA in 1954. … Digoxin is one of the oldest cardiovascular medications used today.[A178225] It is a common agent used to manage atrial fibrillation and the symptoms of heart failure.
Categories: Compounds used in a research, industrial, or household setting, P-glycoprotein substrates with a Narrow Therapeutic IndexInternational brands: Digocard-G