Advanced Filter

Filter by Group

Filter by Market Availability

Displaying drugs 5301 - 5325 of 5953 in total
Fletikumab is under investigation in clinical trial NCT01038674 (Safety and Tolerability of Anti-IL-20 in Subjects With Rheumatoid Arthritis).
Investigational
Depreotide is an ingredient in the EMA-withdrawn product NeoSpect.
Withdrawn
Matched Iupac: … (2S)-6-amino-2-[(2R)-2-[(2S)-6-amino-2-[(2S)-2-amino-3-[2-({2-[(2S,5S,8S,11R,14S,17S)-14-(4-aminobutyl ... ]-3-sulfanylpropanamido]hexanamide ... )-5-benzyl-8-[(4-hydroxyphenyl)methyl]-11-[(1H-indol-3-yl)methyl]-4-methyl-3,6,9,12,15,18-hexaoxo-17- ... (propan-2-yl)-1,4,7,10,13,16-hexaazacyclooctadecan-2-yl]ethyl}sulfanyl)acetamido]propanamido]hexanamido …
Amprolium is a coccidiostat used in poultry.
Experimental
Vet approved
Matched Synonyms: … 1-((4-amino-2-Propyl-5-pyrimidinyl)methyl)-2-picolinium chloride …
Matched Iupac: … 1-[(4-amino-2-propylpyrimidin-5-yl)methyl]-2-methylpyridin-1-ium chloride …
Matched Salts cas: … 137-88-2
Investigational
Matched Synonyms: … 5-fluoro-2-(4-((methylamino)methyl)phenyl)-7-benzofurancarboxamide …
Matched Iupac: … 5-fluoro-2-{4-[(methylamino)methyl]phenyl}-1-benzofuran-7-carboxamide …
Plutavimab is under investigation in clinical trial NCT04900428 (Study to Evaluate a Single Intranasal Dose of STI-2099 (COVI-DROPS™) in Outpatient Adults With COVID-19 (UK)).
Investigational
Matched Synonyms: … Immunoglobulin g1 (234-alanine,235-alanine), anti-(severe acute respiratory syndrome coronavirus 2 spike …
Modakafusp alfa is under investigation in clinical trial NCT03215030 (A Study to Investigate the Safety, Tolerability, Efficacy, Pharmacokinetics, and Immunogenicity of TAK-573 in Participants With Refractory Multiple Myeloma (MM)).
Investigational
E1v1.11 is an antisense oligonucleotide targeting the SMN2 gene which is under investigation for the treatment of spinal muscular atrophy (SMA).
Investigational
Matched Synonyms: … Phosphorodiamidate morpholino oligomer (5'- CTATATATAGTTATTCAACA -3') …
Investigational
Matched Iupac: … (10R)-10-(methylamino)-1,3-diazatricyclo[6.3.1.0^{4,12}]dodeca-4,6,8(12)-trien-2-one …
Matched Categories: … Heterocyclic Compounds, 2-Ring …
Investigational
Matched Synonyms: … 2-aminoglutaric acid ... 2-amino-5-guanidino-pentanoic acid ... 2-amino-5-(diaminomethylideneamino)pentanoic acid …
Matched Iupac: … (2S)-2-amino-5-carbamimidamidopentanoic acid; (2S)-2-aminopentanedioic acid …
Nutraceutical
Matched Iupac: … 5-yl]oxy}-6-(hydroxymethyl)oxan-3-yl]oxy}-6-(hydroxymethyl)oxane-3,4,5-triol ... -trihydroxyoxan-2-yl]oxy}methyl)oxan-2-yl]oxy}hept-5-en-2-yl]tetracyclo[8.7.0.0²,⁷.0¹¹,¹⁵]heptadecan- ... (2S,3R,4S,5S,6R)-2-{[(2R,3R,4S,5S,6R)-4,5-dihydroxy-2-{[(1R,2R,5S,7R,10R,11R,14S,15R,16R)-16-hydroxy- ... 2,6,6,10,11-pentamethyl-14-[(2S)-6-methyl-2-{[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-({[(2S,3R,4S,5S)-3,4,5 …
AUY922 has been used in trials studying the treatment of Lymphoma, Breast Cancer, Metastatic Disease, Advanced Solid Tumors, and Hematologic Neoplasms, among others.
Investigational
Matched Iupac: … 5-(5-tert-butyl-2,4-dihydroxyphenyl)-N-ethyl-4-{4-[(morpholin-4-yl)methyl]phenyl}-1,2-oxazole-3-carboxamide …
PF-03654764 has been used in trials studying the basic science and treatment of Allergic Rhinitis.
Investigational
Matched Iupac: … (1r,3r)-3-fluoro-3-{3-fluoro-4-[(pyrrolidin-1-yl)methyl]phenyl}-N-(2-methylpropyl)cyclobutane-1-carboxamide …
Omipalisib has been used in trials studying the treatment of CANCER, Solid Tumours, and Idiopathic Pulmonary Fibrosis.
Investigational
Matched Iupac: … 2,4-difluoro-N-{2-methoxy-5-[4-(pyridazin-4-yl)quinolin-6-yl]pyridin-3-yl}benzene-1-sulfonamide …
Matched Categories: … Heterocyclic Compounds, 2-Ring ... Phosphatidylinositol 3-Kinases, antagonists & inhibitors …
ABT-072 is under investigation in clinical trial NCT00890318 (A Study in Healthy Adult Subjects to Evaluate the Safety, Tolerability, and Pharmacokinetic Profiles of Multiple Doses of ABT-072 Used to Treat Hepatitis C).
Investigational
Matched Iupac: … N-{4-[(1E)-2-[3-tert-butyl-5-(2,4-dioxo-1,2,3,4-tetrahydropyrimidin-1-yl)-2-methoxyphenyl]ethenyl]phenyl …
GLPG-0974 is under investigation in clinical trial NCT01721980 (Multiple Ascending Dose Study of GLPG0974 in Healthy Subjects).
Investigational
Matched Iupac: … 4-{1-[(2R)-1-(1-benzothiophene-3-carbonyl)-2-methylazetidin-2-yl]-N-[(3-chlorophenyl)methyl]formamido …
Sovleplenib is a novel, investigational, selective small molecule inhibitor for oral administration targeting spleen tyrosine kinase (Syk). It is under investigation in clinical trial NCT03483948 (Phase I Study of Hmpl-523+azacitidine in Elderly Patients With Acute Myeloid Leukemia).
Investigational
Matched Iupac: … 7-[4-(1-methanesulfonylpiperidin-4-yl)phenyl]-N-{[(2S)-morpholin-2-yl]methyl}pyrido[3,4-b]pyrazin-5-amine …
5-methyl-2'-fluoroarauracil F-18 is under investigation in clinical trial NCT02809690 (18F-FMAU PET/CT in Diagnosing and Characterizing Prostate Cancer).
Investigational
Matched Name: … 5-methyl-2'-fluoroarauracil F-18 …
Matched Iupac: … 1-[(2R,3S,4R,5R)-3-(¹⁸F)fluoro-4-hydroxy-5-(hydroxymethyl)oxolan-2-yl]-5-methyl-1,2,3,4-tetrahydropyrimidine …
Matched Description: … 5-methyl-2'-fluoroarauracil F-18 is under investigation in clinical trial NCT02809690 (18F-FMAU PET/CT …
Hyperimmune immunoglobulin to SARS-CoV-2 (hIVIG) is obtained from the plasma of patients who recover from COVID-19 and develop neutralizing antibodies. Anti-coronavirus immunoglobulin is derived from COVID-19 convalescent plasma(https://go.drugbank.com/drugs/DB15692) but contains more SARS-CoV-2 neutralizing antibodies than found in convalescent plasma (https://go.drugbank.com/drugs/DB15692) as the antibodies are highly purified and concentrated.[L27521, L27526]
Investigational
Matched Synonyms: … SARS-CoV-2 immunoglobulin ... SARS-CoV-2 antibody-based IVIG ... Hyperimmune immunoglobulin to SARS-CoV-2
Matched Name: … Anti-SARS-CoV-2 immunoglobulin …
Matched Description: … Hyperimmune immunoglobulin to SARS-CoV-2 (hIVIG) is obtained from the plasma of patients who recover ... from [COVID-19 convalescent plasma](https://go.drugbank.com/drugs/DB15692) but contains more SARS-CoV-2
Canertinib is a pan-erbB tyrosine kinase inhibitor which work against esophageal squamous cell carcinoma in vitro and in vivo. Canertinib treatment significantly affects tumour metabolism, proliferation and hypoxia as determined by PET.
Investigational
Matched Iupac: … N-{4-[(3-chloro-4-fluorophenyl)amino]-7-[3-(morpholin-4-yl)propoxy]quinazolin-6-yl}prop-2-enamide …
Matched Salts cas: … 289499-45-2
Vofopitant has been used in trials studying the treatment of PTSD, Primary Insomnia, and Sleep Initiation and Maintenance Disorders.
Investigational
Matched Iupac: … (2S,3S)-N-({2-methoxy-5-[5-(trifluoromethyl)-1H-1,2,3,4-tetrazol-1-yl]phenyl}methyl)-2-phenylpiperidin ... -3-amine …
LGH-447 is under investigation in clinical trial NCT02160951 (Dose Escalation Study of LGH447 in Japanese Patients With Relapsed and/or Refractory Hematologic Malignancies).
Investigational
Matched Iupac: … N-{4-[(1R,3S,5S)-3-amino-5-methylcyclohexyl]pyridin-3-yl}-6-(2,6-difluorophenyl)-5-fluoropyridine-2-carboxamide …
Fisogatinib is under investigation in clinical trial NCT04194801 (A Phase Ib/ii Study of Fisogatinib(blu-554) in Subjects With Hepatocellular Carcinoma).
Investigational
Matched Iupac: … N-[(3S,4S)-3-{[6-(2,6-dichloro-3,5-dimethoxyphenyl)quinazolin-2-yl]amino}oxan-4-yl]prop-2-enamide …
Matched Categories: … Heterocyclic Compounds, 2-Ring …
Investigational
Matched Synonyms: … S-(2-aminoethyl) phosphorothioate ... Ethanethiol, 2-amino-, 1-(dihydrogen phosphate) ... Phosphorothioic acid, s-(2-aminoethyl) ester …
Matched Iupac: … [(2-aminoethyl)sulfanyl]phosphonic acid …
Bifidobacterium Longum Infantis 35624 is a probiotic being investigated for the treatment of gastrointestinal disorders, such as Crohn's disease and irritable bowel syndrome.[A259872, A259877]
Investigational
Vedroprevir has been investigated for the treatment of Hepatitis C, Chronic.
Investigational
Matched Iupac: … yl}quinolin-4-yl}oxy)-1-[(2S)-3,3-dimethyl-2-({[(1R,3r,5S)-bicyclo[3.1.0]hexan-3-yloxy]carbonyl}amino ... (1R,2R)-1-[(2S,4R)-4-({8-chloro-7-[2-(morpholin-4-yl)ethoxy]-2-{2-[(propan-2-yl)amino]-1,3-thiazol-4- ... )butanoyl]pyrrolidine-2-amido]-2-ethylcyclopropane-1-carboxylic acid …
Matched Categories: … Heterocyclic Compounds, 2-Ring …
Displaying drugs 5301 - 5325 of 5953 in total