

Prilocaine is a local anesthetic used in dental procedures.

Brand Names
Agoneaze, Anodyne Lpt, Citanest, Citanest Forte, Dermacinrx Prikaan, Emla, Fortacin, Lido Bdk, Lido-prilo Caine Pack, Lidopril, Oraqix, Prilolid, Prizotral, Relador
Generic Name
DrugBank Accession Number

A local anesthetic that is similar pharmacologically to lidocaine. Currently, it is used most often for infiltration anesthesia in dentistry. (From AMA Drug Evaluations Annual, 1992, p165)

Small Molecule
Average: 220.3107
Monoisotopic: 220.157563272
Chemical Formula
  • 2-(Propylamino)-o-propionotoluidide
  • 2-Methyl-alpha-propylaminopropionanilide
  • alpha-n-Propylamino-2-methylpropionanilide
  • N-(2-Methylphenyl)-2-(propylamino)propanamide
  • o-Methyl-2-propylaminopropionanilide
  • o-Methyl-alpha-propylaminopropionanilide
  • Prilocain
  • Prilocaina
  • Prilocaïne
  • Prilocaine
  • Prilocaine base
  • Prilocainum
  • Propitocaine
External IDs
  • ASTRA 1512
  • ASTRA 1515
  • ASTRA-1512
  • ASTRA-1515
  • L 67



Used as a local anaesthetic and is often used in dentistry.

Reduce drug development failure rates
Build, train, & validate machine-learning models
with evidence-based and structured datasets.
See how
Build, train, & validate predictive machine-learning models with structured datasets.
See how
Associated Therapies
Contraindications & Blackbox Warnings
Avoid life-threatening adverse drug events
Improve clinical decision support with information on contraindications & blackbox warnings, population restrictions, harmful risks, & more.
Learn more
Avoid life-threatening adverse drug events & improve clinical decision support.
Learn more

Prilocaine binds to the intracellular surface of sodium channels which blocks the subsequent influx of sodium into the cell. Action potential propagation and never function is, therefore, prevented. This block is reversible and when the drug diffuses away from the cell, sodium channel function is restored and nerve propagation returns.

Mechanism of action

Prilocaine acts on sodium channels on the neuronal cell membrane, limiting the spread of seizure activity and reducing seizure propagation. The antiarrhythmic actions are mediated through effects on sodium channels in Purkinje fibers.

ASodium channel protein type 5 subunit alpha

Not Available

Volume of distribution

Not Available

Protein binding

Prilocaine is 55% protein bound in plasma at a concentraion of 0.5-1.0 mg/mL.1

Not Available
Route of elimination

Prilocaine is metabolized in both the liver and the kidney and excreted via the kidney.


Not Available


Not Available

Adverse Effects
Improve decision support & research outcomes
With structured adverse effects data, including: blackbox warnings, adverse reactions, warning & precautions, & incidence rates.
Learn more
Improve decision support & research outcomes with our structured adverse effects data.
Learn more

Not Available

Prilocaine Action PathwayDrug action
Pharmacogenomic Effects/ADRs
Interacting Gene/EnzymeAllele nameGenotype(s)Defining Change(s)Type(s)DescriptionDetails
Glucose-6-phosphate 1-dehydrogenaseVilleurbanneNot Available1000_1002delACCADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseTorunNot Available1006A->GADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSunderlandNot Available105_107delCATADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseIwatsukiNot Available1081G->AADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSerresNot Available1082C->TADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseTondelaNot Available1084_1101delCTGAACGAGCGCAAGGCCADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseLoma LindaNot Available1089C->AADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseAachenNot Available1089C->GADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseTenriNot Available1096A->GADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseMontpellierNot Available1132G>AADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseCalvo MackennaNot Available1138A->GADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseRileyNot Available1139T->CADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseOlomoucNot Available1141T->CADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseTomahNot Available1153T->CADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseLynwoodNot Available1154G->TADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseMadridNot Available1155C->GADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseIowa, Walter Reed, SpringfieldNot Available1156A->GADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseBeverly Hills, Genova, Iwate, Niigata, YamaguchiNot Available1160G->AADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseHartfordNot Available1162A->GADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenasePrahaNot Available1166A->GADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseKrakowNot Available1175T>CADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseWisconsinNot Available1177C->GADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseNashville, Anaheim, PorticiNot Available1178G->AADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseAlhambraNot Available1180G->CADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseBariNot Available1187C->TADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenasePuerto LimonNot Available1192G->AADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseCovao do LoboNot Available1205C>AADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseClinicNot Available1215G->AADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseUtrechtNot Available1225C->TADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSuwalkiNot Available1226C->GADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseRiversideNot Available1228G->TADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseJapan, ShinagawaNot Available1229G->AADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseKawasakiNot Available1229G->CADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseMunichNot Available1231A->GADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseGeorgiaNot Available1284C->AADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSumareNot Available1292T->GADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseTelti/KobeNot Available1318C->TADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSantiago de Cuba, MoriokaNot Available1339G->AADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseHarimaNot Available1358T->AADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseFiguera da FozNot Available1366G->CADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseAmiensNot Available1367A>TADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseBangkok NoiNot Available1376G->T, 1502T->GADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseFukayaNot Available1462G->AADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseCampinasNot Available1463G->TADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseBuenos AiresNot Available1465C>TADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseArakawaNot Available1466C->TADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseBrightonNot Available1488_1490delGAAADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseKozukataNot Available159G->CADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseAmsterdamNot Available180_182delTCTADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseNo nameNot Available202G->A, 376A->G, 1264C>GADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSwanseaNot Available224T->CADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseUrayasuNot Available281_283delAGAADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseVancouverNot Available317C->G544C->T592C->TADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseMt SinaiNot Available376A->G, 1159C->TADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenasePlymouthNot Available488G->AADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseVolendamNot Available514C->TADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseShinshuNot Available527A->GADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseChikugoNot Available535A->TADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseTsukuiNot Available561_563delCTCADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenasePedoplis-CkaroNot Available573C>GADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSantiagoNot Available593G->CADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseMinnesota, Marion, Gastonia, LeJeuneNot Available637G->TADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseCincinnatiNot Available637G->T, 1037A->TADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseHarilaouNot Available648T->GADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseNorth DallasNot Available683_685delACAADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseAsahikawaNot Available695G->AADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseDurhamNot Available713A->GADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseStonybrookNot Available724_729delGGCACTADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseWayneNot Available769C->GADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseAveiroNot Available806G->AADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseCleveland CorumNot Available820G->AADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseLilleNot Available821A>TADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseBangkokNot Available825G>CADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSugaoNot Available826C->TADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseLa JollaNot Available832T->CADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseWexhamNot Available833C->TADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenasePiotrkowNot Available851T>CADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseWest VirginiaNot Available910G->TADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseOmiyaNot Available921G->CADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseNaraNot Available953_976delCCACCAAAGGGTACCTGGAC GACCADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseManhattanNot Available962G->AADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseRehevotNot Available964T->CADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseHoniaraNot Available99A->G / 1360C->TADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseTokyo, FukushimaNot Available1246G->AADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseChathamNot Available1003G->AADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseFushanNot Available1004C->AADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenasePartenopeNot Available1052G->TADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseIerapetraNot Available1057C->TADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseAnadiaNot Available1193A->GADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseAbenoNot Available1220A->CADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSurabayaNot Available1291G->AADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenasePawneeNot Available1316G->CADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseS. AntiocoNot Available1342A->GADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseCassanoNot Available1347G->CADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseHermoupolisNot Available1347G->C / 1360C->TADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseUnion,Maewo, Chinese-2, KaloNot Available1360C->TADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseAndalusNot Available1361G->AADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseCosenzaNot Available1376G->CADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseCanton, Taiwan- Hakka, Gifu-like, Agrigento-likeNot Available1376G->TADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseFloresNot Available1387C->AADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseKaiping, Anant, Dhon, Sapporo-like, WoseraNot Available1388G->AADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseKamogawaNot Available169C->TADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseCostanzoNot Available179T>CADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseAmazoniaNot Available185C->AADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSongklanagarindNot Available196T->AADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseHechiNot Available202G->A / 871G->AADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseNamouruNot Available208T->CADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseBao LocNot Available352T>CADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseCrispimNot Available375G->T, 379G->T383T->C384C>TADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseAcrokorinthosNot Available376A->G / 463C->GADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSanta MariaNot Available376A->G / 542A->TADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseAnanindeuaNot Available376A->G / 871G->AADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseVanua LavaNot Available383T->CADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseValladolidNot Available406C->TADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseBelemNot Available409C->TADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseLiuzhouNot Available442G->AADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseShenzenNot Available473G>AADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseTaipei “Chinese- 3”Not Available493A->GADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseToledoNot Available496C>TADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseNaoneNot Available497G->AADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseNankangNot Available517T->CADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseMiaoliNot Available519C->GADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseMediterranean, Dallas, Panama‚ Sassari, Cagliari, BirminghamNot Available563C->TADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseCoimbra ShundeNot Available592C->TADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseNilgiriNot Available593G>AADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseRadlowoNot Available679C->TADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseRoubaixNot Available811G>CADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseHaikouNot Available835A->GADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseChinese-1Not Available835A->TADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseMizushimaNot Available848A>GADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseOsakaNot Available853C->TADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseViangchan, JammuNot Available871G->AADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSeoulNot Available916G->AADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseLudhianaNot Available929G->AADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseFarroupilhaNot Available977C->AADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseChinese-5Not Available1024C->TADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseRignanoNot Available130G>AADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseOrissaNot Available131C->GADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseG6PDNiceNot Available1380G>CADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseKamiube, KeelungNot Available1387C->TADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseNeapolisNot Available1400C->GADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseAuresNot Available143T->CADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSplitNot Available1442C->GADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseKambosNot Available148C->TADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenasePalestrinaNot Available170G>AADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseMetapontoNot Available172G->AADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseMusashinoNot Available185C->TADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseAsahiNot Available202G->AADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseA- (202), Ferrara INot Available202G->A / 376A->GADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseMurcia OristanoNot Available209A->GADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseUbe KonanNot Available241C->TADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseLagosantoNot Available242G->AADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseGuangzhouNot Available274C->TADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseHammersmithNot Available323T->AADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSinnaiNot Available34G->TADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseA- (680)Not Available376A->G / 680G->TADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseA- (968), Betica,Selma, GuantanamoNot Available376A->G / 968T->CADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSalerno PyrgosNot Available383T>GADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseQuing YanNot Available392G->TADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseLagesNot Available40G->AADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseIleshaNot Available466G->AADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseMahidolNot Available487G->AADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseMalagaNot Available542A->TADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSibariNot Available634A->GADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseMexico CityNot Available680G->AADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseNanningNot Available703C->TADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSeattle, Lodi, Modena, Ferrara II, Athens-likeNot Available844G->CADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseBajo MaumereNot Available844G->TADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseMontalbanoNot Available854G->AADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseKalyan-Kerala, Jamnaga, RohiniNot Available949G->AADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseGaoheNot Available95A->GADR InferredIncreased risk of Methemoglobinemia.Details
NADH-cytochrome b5 reductase 3---Not AvailableExon 2 c.129C>A / Exon 2 c.149G>A  … show all ADR InferredIncreased risk of Methemoglobinemia.Details


Drug Interactions
This information should not be interpreted without the help of a healthcare provider. If you believe you are experiencing an interaction, contact a healthcare provider immediately. The absence of an interaction does not necessarily mean no interactions exist.
1,2-BenzodiazepineThe risk or severity of adverse effects can be increased when Prilocaine is combined with 1,2-Benzodiazepine.
AbemaciclibThe risk or severity of methemoglobinemia can be increased when Abemaciclib is combined with Prilocaine.
AbirateroneThe risk or severity of methemoglobinemia can be increased when Abiraterone is combined with Prilocaine.
AcetaminophenThe risk or severity of methemoglobinemia can be increased when Acetaminophen is combined with Prilocaine.
AcetazolamideThe risk or severity of methemoglobinemia can be increased when Acetazolamide is combined with Prilocaine.
Acetic acidThe risk or severity of methemoglobinemia can be increased when Acetic acid is combined with Prilocaine.
AcetophenazineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Acetophenazine.
Acetyl sulfisoxazoleThe risk or severity of methemoglobinemia can be increased when Acetyl sulfisoxazole is combined with Prilocaine.
AclidiniumPrilocaine may increase the central nervous system depressant (CNS depressant) activities of Aclidinium.
AdagrasibThe risk or severity of methemoglobinemia can be increased when Adagrasib is combined with Prilocaine.
Identify potential medication risks
Easily compare up to 40 drugs with our drug interaction checker.
Get severity rating, description, and management advice.
Learn more
Food Interactions
  • Take separate from meals. This is only required when prilocaine is used in the mouth, as it may cause numbness, which can cause bite injury when eating.


Drug product information from 10+ global regions
Our datasets provide approved product information including:
dosage, form, labeller, route of administration, and marketing period.
Access now
Access drug product information from over 10 global regions.
Access now
Product Ingredients
IngredientUNIICASInChI Key
Prilocaine hydrochlorideMJW015BAPH1786-81-8BJPJNTKRKALCPP-UHFFFAOYSA-N
International/Other Brands
Citanest (AstraZeneca) / Prilotekal (Goldshield) / Takipril (Meduna) / Xylonest (AstraZeneca)
Brand Name Prescription Products
NameDosageStrengthRouteLabellerMarketing StartMarketing EndRegionImage
4% Citanest Plain DentalSolution40 mg / mLInfiltrationDentsply Pharmaceutical2015-12-23Not applicableCanada flag
Citanest PlainInjection, solution40 mg/1mLDentalDentsply Pharmaceutical2007-03-022007-03-02US flag
Dentsply 4% Prilocaine Hydrochloride Dental InjectionSolution40 mg / mLInfiltrationDentsply Pharmaceutical1964-12-312016-06-03Canada flag
Truemed Group LLCInjection54 mg/54mgIntramuscularTruemed Group LLC2022-09-17Not applicableUS flag
Generic Prescription Products
NameDosageStrengthRouteLabellerMarketing StartMarketing EndRegionImage
Citanest PlainInjection, solution40 mg/1mLSubmucosalDentsply Pharmaceutical Inc.1965-11-18Not applicableUS flag
Prilocaine HydrochlorideInjection, solution40 mg/1mLSubcutaneousSeptodont2011-01-01Not applicableUS flag
Mixture Products
NameIngredientsDosageRouteLabellerMarketing StartMarketing EndRegionImage
4% Citanest Forte Dental With Epinephrine 1:200,000Prilocaine hydrochloride (40 mg / mL) + Epinephrine (0.005 mg / mL)SolutionInfiltrationDentsply Pharmaceutical2011-01-18Not applicableCanada flag
Anodyne LPTPrilocaine (25 mg/1g) + Lidocaine (25 mg/1g)KitTopicalFortus Pharma, Llc2017-03-22Not applicableUS flag
Citanest FortePrilocaine hydrochloride (40 mg/1mL) + Epinephrine bitartrate (0.005 mg/1mL)Injection, solutionSubmucosalDentsply Pharmaceutical1965-11-18Not applicableUS flag
Citanest Forte DENTALPrilocaine hydrochloride (40 mg/1mL) + Epinephrine bitartrate (0.005 mg/1mL)Injection, solutionParenteralDentsply Pharmaceutical Inc.2017-12-04Not applicableUS flag
CITANEST OCTAPRESSIN INJECTIONPrilocaine hydrochloride (66 mg/2.2ml) + Felypressin (0.066 iu/2.2ml)InjectionBuccalDENTSPLY (SINGAPORE) PTE. LTD.1991-03-05Not applicable
Dentsply 4% Prilocaine and Epinephrine Injection 1:200,000Prilocaine hydrochloride (40 mg / mL) + Epinephrine bitartrate (5 mcg / mL)SolutionInfiltrationDentsply Pharmaceutical1968-12-312012-07-19Canada flag
DermacinRx Cinlone-I CPIPrilocaine (25 mg/1g) + Lidocaine (25 mg/1g) + Triamcinolone acetonide (40 mg/1mL)Cream; Injection, suspension; KitIntra-articular; Intramuscular; TopicalPureTek Corporation2016-05-172019-04-22US flag
DermacinRx Cinlone-II CPIPrilocaine (25 mg/1g) + Lidocaine (25 mg/1g) + Triamcinolone acetonide (40 mg/1mL)Cream; Injection, suspension; KitIntra-articular; Intramuscular; TopicalPureTek Corporation2016-06-242019-05-15US flag
DermacinRx PrikaanPrilocaine (25 mg/1g) + Lidocaine (25 mg/1g)KitTopicalShoreline Pharmaceuticals, Inc.2016-07-01Not applicableUS flag
DolotranzPrilocaine (25 mg/1g) + Lidocaine (25 mg/1g) + Lidocaine (4 g/100mL)Cream; Gel; KitTopicalTaleos Pharma2017-01-012018-10-24US flag
Unapproved/Other Products
NameIngredientsDosageRouteLabellerMarketing StartMarketing EndRegionImage
ACAT SUK Kit (Accelerated COVID-19 Antibody Test Single Use Kit)Prilocaine (25 mg/1g) + Isopropyl alcohol (70 mL/100mL) + Lidocaine (25 mg/1g)KitTopicalAsclemed Usa, Inc.2020-04-25Not applicableUS flag
ACT Kit (Accelerated COVID-19 Test Kit)Prilocaine (25 mg/1g) + Isopropyl alcohol (70 mL/100mL) + Lidocaine (25 mg/1g)KitTopicalAsclemed Usa, Inc.2020-04-13Not applicableUS flag
AgonEazePrilocaine (25 mg/1g) + Prilocaine (25 mg/1g) + Lidocaine (25 mg/1g) + Lidocaine (25 mg/1g)KitTopicalAlvix Laboratories2016-01-12Not applicableUS flag
AgonEazePrilocaine (25 mg/1g) + Prilocaine (25 mg/1g) + Lidocaine (25 mg/1g) + Lidocaine (25 mg/1g)KitTopicalAlvix Laboratories2016-01-12Not applicableUS flag
Aprizio PakPrilocaine (25 mg/1g) + Lidocaine (25 mg/1g)KitTopicalPureTek Corporation2018-06-06Not applicableUS flag
Aprizio Pak IIPrilocaine (25 mg/1g) + Lidocaine (25 mg/1g)Cream; KitTopicalPureTek Corporation2020-06-11Not applicableUS flag
Cadira Compliant Blood StatPrilocaine (25 mg/1g) + Lidocaine (25 mg/1g)CreamTopicalAsclemed Usa, Inc.2003-08-27Not applicableUS flag
CyclopakPrilocaine (25 mg/1g) + Cyclobenzaprine hydrochloride (5 mg/1) + Lidocaine (25 mg/1g)Cream; Kit; Tablet, film coatedOral; TopicalPureTek Corporation2020-11-30Not applicableUS flag
DermacinRx EmpricainePrilocaine (25 mg/1g) + Lidocaine (25 mg/1g)KitTopicalPureTek Corporation2016-08-022021-06-30US flag
DermacinRx Empricaine IIPrilocaine (25 mg/1g) + Lidocaine (25 mg/1g)Cream; KitTopicalPureTek Corporation2020-06-02Not applicableUS flag


ATC Codes
N01BB54 — Prilocaine, combinationsN01BB04 — Prilocaine
Drug Categories
Chemical TaxonomyProvided by Classyfire
This compound belongs to the class of organic compounds known as alpha amino acid amides. These are amide derivatives of alpha amino acids.
Organic compounds
Super Class
Organic acids and derivatives
Carboxylic acids and derivatives
Sub Class
Amino acids, peptides, and analogues
Direct Parent
Alpha amino acid amides
Alternative Parents
Alanine and derivatives / Anilides / N-arylamides / Toluenes / Secondary carboxylic acid amides / Dialkylamines / Organopnictogen compounds / Organic oxides / Hydrocarbon derivatives / Carbonyl compounds
Alanine or derivatives / Alpha-amino acid amide / Amine / Anilide / Aromatic homomonocyclic compound / Benzenoid / Carbonyl group / Carboxamide group / Hydrocarbon derivative / Monocyclic benzene moiety
Molecular Framework
Aromatic homomonocyclic compounds
External Descriptors
monocarboxylic acid amide, amino acid amide (CHEBI:8404)
Affected organisms
  • Humans and other mammals

Chemical Identifiers

CAS number
InChI Key


Synthesis Reference
General References
  1. DailyMed: Prilocaine Hydrochloride Subcutaneous Injection [Link]
Human Metabolome Database
KEGG Compound
PubChem Compound
PubChem Substance
Therapeutic Targets Database
Download (73.4 KB)

Clinical Trials

Clinical Trials
4Active Not RecruitingTreatmentAnesthesia therapy / Anesthetics Adverse Reaction1
4CompletedNot AvailableHaemorrhoids / Peri-anal Fistulas1
4CompletedOtherForehead Rhytides / Forehead Wrinkles1
4CompletedOtherPeriodontal Disease1
4CompletedPreventionImproving Quality of Life1
4CompletedSupportive CareLeukemias / Non-Hodgkin's Lymphoma (NHL)1
4CompletedSupportive CarePain1
4CompletedSupportive CareTranscervical Resection of Endometrium / Transcervical Resection of Fibroids / Transcervical Resection of Polyp1
4CompletedTreatmentActinic Keratosis (AK)1
4CompletedTreatmentAcute Pain / Lacerations1


Not Available
  • APP Pharmaceuticals
  • Astra Pharma Inc.
  • AstraZeneca Inc.
  • DENTSPLY International
  • Diversified Healthcare Services Inc.
  • E. Fougera and Co.
  • Hi Tech Pharmacal Co. Inc.
  • Medisca Inc.
  • Nycomed Inc.
  • Physicians Total Care Inc.
  • Preferred Pharmaceuticals Inc.
  • Recipharm AB
  • Sandoz
  • Tolmar Inc.
Dosage Forms
SolutionInfiltration40 mg / mL
Injection2 %
Injection, solutionSubmucosal
Injection, solutionParenteral
Injection, solutionDental40 mg/1mL
Injection, solutionSubmucosal40 mg/1mL
Cream; kit; tablet, film coatedOral; Topical
Cream; injection, suspension; kitIntra-articular; Intramuscular; Topical
Cream; kitTopical
Cream; gel; kitTopical
CreamOcclusive dressing technique
KitOral; Topical
KitIntravenous; Topical
SolutionInfiltration40 mg
Injection, solutionIntravenous2 %
SolutionParenteral72 mg
KitCutaneous; Topical
Injection, solution2 %
PowderNot applicable1 g/1g
Injection, solutionSubcutaneous40 mg/1mL
Injection, solutionSubcutaneous
Capsule; cream; kitOral; Topical
Injection, solution
CreamTopical2.5 %w/w
Injection, solutionParenteral
Injection, solutionIntrathecal20.00 mg/ml
InjectionIntramuscular54 mg/54mg
Unit descriptionCostUnit
Prilocaine hcl powder3.98USD g
DrugBank does not sell nor buy drugs. Pricing information is supplied for informational purposes only.
Patent NumberPediatric ExtensionApprovedExpires (estimated)Region
US6031007No2000-02-292017-04-01US flag


Experimental Properties
melting point (°C)37-38 °CPhysProp
boiling point (°C)159-162 °C at 1.00E-01 mm HgPhysProp
water solubility541 mg/LNot Available
logP2.11HANSCH,C ET AL. (1995)
Predicted Properties
Water Solubility0.326 mg/mLALOGPS
pKa (Strongest Acidic)13.51Chemaxon
pKa (Strongest Basic)8.82Chemaxon
Physiological Charge1Chemaxon
Hydrogen Acceptor Count2Chemaxon
Hydrogen Donor Count2Chemaxon
Polar Surface Area41.13 Å2Chemaxon
Rotatable Bond Count5Chemaxon
Refractivity67.86 m3·mol-1Chemaxon
Polarizability25.98 Å3Chemaxon
Number of Rings1Chemaxon
Rule of FiveYesChemaxon
Ghose FilterYesChemaxon
Veber's RuleNoChemaxon
MDDR-like RuleNoChemaxon
Predicted ADMET Features
Human Intestinal Absorption+0.9557
Blood Brain Barrier+0.9285
Caco-2 permeable+0.7888
P-glycoprotein substrateSubstrate0.6968
P-glycoprotein inhibitor INon-inhibitor0.8019
P-glycoprotein inhibitor IINon-inhibitor0.9165
Renal organic cation transporterNon-inhibitor0.895
CYP450 2C9 substrateNon-substrate0.7803
CYP450 2D6 substrateNon-substrate0.5124
CYP450 3A4 substrateNon-substrate0.5253
CYP450 1A2 substrateNon-inhibitor0.9045
CYP450 2C9 inhibitorNon-inhibitor0.907
CYP450 2D6 inhibitorNon-inhibitor0.9232
CYP450 2C19 inhibitorNon-inhibitor0.9026
CYP450 3A4 inhibitorNon-inhibitor0.8309
CYP450 inhibitory promiscuityLow CYP Inhibitory Promiscuity0.6298
Ames testNon AMES toxic0.7941
BiodegradationNot ready biodegradable0.9577
Rat acute toxicity2.1374 LD50, mol/kg Not applicable
hERG inhibition (predictor I)Weak inhibitor0.9676
hERG inhibition (predictor II)Non-inhibitor0.8577
ADMET data is predicted using admetSAR, a free tool for evaluating chemical ADMET properties. (23092397)


Mass Spec (NIST)
Download (8.45 KB)
SpectrumSpectrum TypeSplash Key
Predicted GC-MS Spectrum - GC-MSPredicted GC-MSNot Available
Predicted MS/MS Spectrum - 10V, Positive (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 20V, Positive (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 40V, Positive (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 10V, Negative (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 20V, Negative (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 40V, Negative (Annotated)Predicted LC-MS/MSNot Available
LC-MS/MS Spectrum - LC-ESI-qTof , PositiveLC-MS/MSNot Available
LC-MS/MS Spectrum - LC-ESI-qTof , PositiveLC-MS/MSNot Available
LC-MS/MS Spectrum - LC-ESI-qTof , PositiveLC-MS/MSNot Available
LC-MS/MS Spectrum - LC-ESI-QFT , positiveLC-MS/MSsplash10-000i-9010000000-62668ab56142315d25c7
LC-MS/MS Spectrum - LC-ESI-QFT , positiveLC-MS/MSsplash10-000i-9000000000-b24ca970640547e77f45
LC-MS/MS Spectrum - LC-ESI-QFT , positiveLC-MS/MSsplash10-000i-9000000000-fa235236a550137d65ac
LC-MS/MS Spectrum - LC-ESI-QFT , positiveLC-MS/MSsplash10-000i-9000000000-c5326a5261240ae38b1e
LC-MS/MS Spectrum - LC-ESI-QFT , positiveLC-MS/MSsplash10-000i-9000000000-6c794305d6cd738a7fa3
LC-MS/MS Spectrum - LC-ESI-QFT , positiveLC-MS/MSsplash10-000i-9000000000-ee81ed4cf795affc96e8
MS/MS Spectrum - , positiveLC-MS/MSsplash10-00di-0290000000-ecb70add14abedae843c
MS/MS Spectrum - , positiveLC-MS/MSsplash10-00di-0290000000-44d4259708c3f68cf9fa
MS/MS Spectrum - , positiveLC-MS/MSsplash10-00di-1390000000-c8416e476741832b2637


Build, predict & validate machine-learning models
Use our structured and evidence-based datasets to unlock new
insights and accelerate drug research.
Learn more
Use our structured and evidence-based datasets to unlock new insights and accelerate drug research.
Learn more
Pharmacological action
General Function
Voltage-gated sodium channel activity involved in sa node cell action potential
Specific Function
This protein mediates the voltage-dependent sodium ion permeability of excitable membranes. Assuming opened or closed conformations in response to the voltage difference across the membrane, the pr...
Gene Name
Uniprot ID
Uniprot Name
Sodium channel protein type 5 subunit alpha
Molecular Weight
226937.475 Da
  1. Overington JP, Al-Lazikani B, Hopkins AL: How many drug targets are there? Nat Rev Drug Discov. 2006 Dec;5(12):993-6. [Article]
  2. Imming P, Sinning C, Meyer A: Drugs, their targets and the nature and number of drug targets. Nat Rev Drug Discov. 2006 Oct;5(10):821-34. [Article]
  3. Chen X, Ji ZL, Chen YZ: TTD: Therapeutic Target Database. Nucleic Acids Res. 2002 Jan 1;30(1):412-5. [Article]

Drug created at June 13, 2005 13:24 / Updated at February 02, 2023 04:04