


Glipizide is a sulfonylurea medication used in Type 2 Diabetes to sensitize pancreatic beta cells and stimulate insulin release.

Brand Names
Generic Name
DrugBank Accession Number

Glipizide is an oral hypoglycemic agent in the second-generation sulfonylurea drug class that is used to control blood sugar levels in patients with type 2 diabetes mellitus. It was first introduced in 1984 3 and is available in various countries including Canada and the U.S. According to the 2018 Clinical Practice Guidelines by Diabetes Canada, sulfonylurea drugs are considered a second-line glucose-lowering therapy following metformin.7 Because sulfonylureas require functional pancreatic beta cells for their therapeutic effectiveness, sulfonylureas are more commonly used for early-stage type 2 diabetes when there is no progressed pancreatic failure.6 Compared to the first-generation sulfonylureas, such as tolbutamide and chlorpropamide, second-generation sulfonylureas contain a more non-polar side chain in their chemical structure, which enhances their hypoglycemic potency.2 Compared to other members of the sulfonylurea drug group, glipizide displays rapid absorption and onset of action with the shortest half-life and duration of action, reducing the risk for long-lasting hypoglycemia that is often observed with blood glucose-lowering agents.1 Glipizide was first approved by the FDA in 1994 and is available in extended-release tablets under the brand name Glucotrol®, as well as in combination with metformin under the brand name Metaglip®.

Small Molecule
Approved, Investigational
Average: 445.535
Monoisotopic: 445.178375067
Chemical Formula
  • 1-cyclohexyl-3-({p-[2-(5-methylpyrazinecarboxamido)ethyl]phenyl}sulfonyl)urea
  • Glipizida
  • Glipizide
  • Glipizidum
  • N-{4-[β-(5-methylpyrazine-2-carboxamido)ethyl]benzenesulphonyl}-N'-cyclohexylurea
External IDs
  • CP 28,720
  • CP 28720
  • CP-28,720
  • CP-28720
  • K 4024
  • K-4024



Indicated as an adjunct to diet and exercise to improve glycemic control in adults with type 2 diabetes mellitus.Label

Accelerate your drug discovery research with the industry’s only fully connected ADMET dataset, ideal for:
Machine Learning
Data Science
Drug Discovery
Accelerate your drug discovery research with our fully connected ADMET dataset
Learn more
Associated Conditions
Contraindications & Blackbox Warnings
Contraindications & Blackbox Warnings
With our commercial data, access important information on dangerous risks, contraindications, and adverse effects.
Learn more
Our Blackbox Warnings cover Risks, Contraindications, and Adverse Effects
Learn more

Glipizide is a blood glucose-lowering agent. The initial onset of blood glucose-lowering effect occurs around 30 minutes post-administration with the duration of action lasting for about 12 to 24 hours.8 While the chronic use of glipizide does not result in elevations in the fasting insulin levels over time, the postprandial insulin response, or insulin response to a meal, is observed to be enhanced, even after 6 months of treatment.Label The main therapeutic actions of glipizide primarily occur at the pancreas where the insulin release is stimulated, but glipizide also mediates some extrapancreatic effects, such as the promotion of insulin signaling effects on the muscles, fat, or liver cells.9 Due to its action on the endogenous cells, sulfonylureas including glipizide is associated with a risk for developing hypoglycemia and weight gain in patients receiving the drug.5,6 Chronic administration of glipizide may result in down-regulation of the sulfonylurea receptors on pancreatic beta cells, which are molecular targets of the drug, leading to a reduced effect on insulin secretion.4

Like other sulfonylureas, glipizide may work on pancreatic delta (δ) cells and alpha (α) cells to stimulate the secretion of somatostatin and suppress the secretion of glucagon, which are peptide hormones that regulate neuroendocrine and metabolic pathways. Other than its primary action on the pancreas, glipizide also exerts other biological actions outside of the pancreas, or "extrapancreatic effects", which is similar to other members of the sulfonylurea drug class. Glipizide may enhance the glucose uptake into the skeletal muscles and potentiate the action of insulin in the liver. Other effects include inhibited lipolysis in the liver and adipose tissue, inhibited hepatic glucose output, and increased uptake and oxidation of glucose. It has also been demonstrated by several studies that the chronic therapeutic use of sulfonylureas may result in an increase in insulin receptors expressed on monocytes, adipocytes, and erythrocytes.4

Mechanism of action

Type 2 diabetes mellitus (T2DM) is a chronic metabolic disorder with increasing prevalence worldwide. Characterized by higher-than-normal levels of blood glucose, T2DM is a complex disorder that arises from the interaction between genetic, environmental and behavioral risk factors. Insulin is a peptide hormone that plays a critical role in regulating blood glucose levels. In response to high blood glucose levels, insulin promotes the uptake of glucose into the liver, muscle cells, and fat cells for storage. Although there are multiple events occurring that lead to the pathophysiology of T2DM, the disorder mainly involves insulin insensitivity as a result of insulin resistance, declining insulin production, and eventual failure of beta cells of pancreatic islets that normally produce insulin.5 Early management with lifestyle intervention, such as controlled diet and exercise, is critical in reducing the risk of long-term secondary complications, such as cardiovascular mortality.

Glipizide, like other sulfonylurea drugs, is an insulin secretagogue, which works by stimulating the insulin release from the pancreatic beta cells thereby increasing the plasma concentrations of insulin.4 Thus, the main therapeutic action of the drug depends on the functional beta cells in the pancreatic islets.8 Sulfonylureas bind to the sulfonylurea receptor expressed on the pancreatic beta-cell plasma membrane, leading to the closure of the ATP-sensitive potassium channel and reduced potassium conductance. This results in depolarization of the pancreatic beta cell and opening of the voltage-sensitive calcium channels, promoting calcium ion influx. Increased intracellular concentrations of calcium ions in beta cells stimulates the secretion, or exocytosis, of insulin granules from the cells.Label,6 Apart from this main mechanism of action, the blood-glucose-lowering effect of glipizide involves increased peripheral glucose utilization via stimulating hepatic gluconeogenesis and by increasing the number and sensitivity of insulin receptors.4

AATP-binding cassette sub-family C member 8
UPeroxisome proliferator-activated receptor gamma

Gastrointestinal absorption of glipizide is uniform, rapid, and essentially complete.1 The absolute bioavailability of glipizide in patients with type 2 diabetes receiving a single oral dose was 100%. The maximum plasma concentrations are expected to be reached within 6 to 12 hours following initial dosing. The steady-state plasma concentrations of glipizide from extended-release oral formulations are maintained over the 24-hour dosing interval.Label In healthy volunteers, the absorption of glipizide was delayed by the presence of food but the total absorption was unaffected.9

Volume of distribution

The mean volume of distribution was approximately 10 L following administration of single intravenous doses in patients with type 2 diabetes mellitus.Label In mice and rat studies, the presence of the drug and its metabolites was none to minimal in the fetus of pregnant female animals.9 Other sulfonylurea drugs were shown to cross the placenta and enter breast milk 6 thus the potential risk of glipizide in fetus or infants cannot be excluded.

Protein binding

Glipizide is about 98-99% bound to serum proteins, with albumin being the main plasma protein.Label


Glipizide is subject to hepatic metabolism, in which its major metabolites are formed from aromatic hydroxylation. These major metabolites are glipizide are reported to be pharmacologically inactive. In contrast, an acetylaminoethyl benzine derivative is formed as a minor metabolite which accounts for less than 2% of the initial dose and is reported to have one-tenth to one-third as much hypoglycemic activity as the parent compound.Label

Hover over products below to view reaction partners

Route of elimination

Glipizide is mainly eliminated by hepatic biotransformation, where less than 10% of the initial dose of the drug can be detected in the urine and feces as unchanged glipizide. About 80% of the metabolites of glipizide is excreted in the urine while 10% is excreted in the feces.Label


The mean terminal elimination half-life of glipizide ranged from 2 to 5 hours after single or multiple doses in patients with type 2 diabetes mellitus.Label


The mean total body clearance of glipizide was approximately 3 L/hr following administration of single intravenous doses in patients with type 2 diabetes mellitus.Label

Adverse Effects
Reduce medical errors
and improve treatment outcomes with our comprehensive & structured data on drug adverse effects.
Learn more
Reduce medical errors & improve treatment outcomes with our adverse effects data
Learn more

In rats, the oral LD50 is reported to be greater than 4000 mg/kg and the intraperitoneal LD50 is 1200 mg/kg. The lowest published toxic dose (TDLo) via oral route in child was 379 μg/kg.MSDS

Symptoms of overdose in sulfonylureas, including glipizide, may be related to severe hypoglycemia and may include coma, seizure, or other neurological impairment. These are symptoms of severe hypoglycemia and require immediate treatment with glucagon or intravenous glucose and close monitoring for a minimum of 24 to 48 hours since hypoglycemia may recur after apparent clinical recovery. Mild hypoglycemic symptoms without loss of consciousness or neurologic findings should be treated with oral glucose.Label

Not Available
Pharmacogenomic Effects/ADRs
Interacting Gene/EnzymeAllele nameGenotype(s)Defining Change(s)Type(s)DescriptionDetails
Cytochrome P450 2C9CYP2C9*3(C;C) / (A;C)C AlleleEffect Directly StudiedPatients with this genotype have reduced metabolism of glipizide.Details
Glucose-6-phosphate 1-dehydrogenaseVilleurbanneNot Available1000_1002delACCADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTorunNot Available1006A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSunderlandNot Available105_107delCATADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseIwatsukiNot Available1081G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSerresNot Available1082C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTondelaNot Available1084_1101delCTGAACGAGCGCAAGGCCADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLoma LindaNot Available1089C->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAachenNot Available1089C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTenriNot Available1096A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMontpellierNot Available1132G>AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCalvo MackennaNot Available1138A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseRileyNot Available1139T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseOlomoucNot Available1141T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTomahNot Available1153T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLynwoodNot Available1154G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMadridNot Available1155C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseIowa, Walter Reed, SpringfieldNot Available1156A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBeverly Hills, Genova, Iwate, Niigata, YamaguchiNot Available1160G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHartfordNot Available1162A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePrahaNot Available1166A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKrakowNot Available1175T>CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseWisconsinNot Available1177C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNashville, Anaheim, PorticiNot Available1178G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAlhambraNot Available1180G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBariNot Available1187C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePuerto LimonNot Available1192G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCovao do LoboNot Available1205C>AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseClinicNot Available1215G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseUtrechtNot Available1225C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSuwalkiNot Available1226C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseRiversideNot Available1228G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseJapan, ShinagawaNot Available1229G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKawasakiNot Available1229G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMunichNot Available1231A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseGeorgiaNot Available1284C->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSumareNot Available1292T->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTelti/KobeNot Available1318C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSantiago de Cuba, MoriokaNot Available1339G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHarimaNot Available1358T->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseFiguera da FozNot Available1366G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAmiensNot Available1367A>TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBangkok NoiNot Available1376G->T, 1502T->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseFukayaNot Available1462G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCampinasNot Available1463G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBuenos AiresNot Available1465C>TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseArakawaNot Available1466C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBrightonNot Available1488_1490delGAAADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKozukataNot Available159G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAmsterdamNot Available180_182delTCTADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNo nameNot Available202G->A, 376A->G, 1264C>GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSwanseaNot Available224T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseUrayasuNot Available281_283delAGAADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseVancouverNot Available317C->G544C->T592C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMt SinaiNot Available376A->G, 1159C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePlymouthNot Available488G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseVolendamNot Available514C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseShinshuNot Available527A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseChikugoNot Available535A->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTsukuiNot Available561_563delCTCADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePedoplis-CkaroNot Available573C>GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSantiagoNot Available593G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMinnesota, Marion, Gastonia, LeJeuneNot Available637G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCincinnatiNot Available637G->T, 1037A->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHarilaouNot Available648T->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNorth DallasNot Available683_685delACAADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAsahikawaNot Available695G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseDurhamNot Available713A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseStonybrookNot Available724_729delGGCACTADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseWayneNot Available769C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAveiroNot Available806G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCleveland CorumNot Available820G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLilleNot Available821A>TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBangkokNot Available825G>CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSugaoNot Available826C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLa JollaNot Available832T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseWexhamNot Available833C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePiotrkowNot Available851T>CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseWest VirginiaNot Available910G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseOmiyaNot Available921G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNaraNot Available953_976delCCACCAAAGGGTACCTGGAC GACCADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseManhattanNot Available962G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseRehevotNot Available964T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHoniaraNot Available99A->G / 1360C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTokyo, FukushimaNot Available1246G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseChathamNot Available1003G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseFushanNot Available1004C->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePartenopeNot Available1052G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseIerapetraNot Available1057C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAnadiaNot Available1193A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAbenoNot Available1220A->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSurabayaNot Available1291G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePawneeNot Available1316G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseS. AntiocoNot Available1342A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCassanoNot Available1347G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHermoupolisNot Available1347G->C / 1360C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseUnion,Maewo, Chinese-2, KaloNot Available1360C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAndalusNot Available1361G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCosenzaNot Available1376G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCanton, Taiwan- Hakka, Gifu-like, Agrigento-likeNot Available1376G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseFloresNot Available1387C->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKaiping, Anant, Dhon, Sapporo-like, WoseraNot Available1388G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKamogawaNot Available169C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCostanzoNot Available179T>CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAmazoniaNot Available185C->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSongklanagarindNot Available196T->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHechiNot Available202G->A / 871G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNamouruNot Available208T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBao LocNot Available352T>CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCrispimNot Available375G->T, 379G->T383T->C384C>TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAcrokorinthosNot Available376A->G / 463C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSanta MariaNot Available376A->G / 542A->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAnanindeuaNot Available376A->G / 871G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseVanua LavaNot Available383T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseValladolidNot Available406C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBelemNot Available409C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLiuzhouNot Available442G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseShenzenNot Available473G>AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTaipei “Chinese- 3”Not Available493A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseToledoNot Available496C>TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNaoneNot Available497G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNankangNot Available517T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMiaoliNot Available519C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMediterranean, Dallas, Panama‚ Sassari, Cagliari, BirminghamNot Available563C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCoimbra ShundeNot Available592C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNilgiriNot Available593G>AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseRadlowoNot Available679C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseRoubaixNot Available811G>CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHaikouNot Available835A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseChinese-1Not Available835A->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMizushimaNot Available848A>GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseOsakaNot Available853C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseViangchan, JammuNot Available871G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSeoulNot Available916G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLudhianaNot Available929G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseFarroupilhaNot Available977C->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseChinese-5Not Available1024C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseRignanoNot Available130G>AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseOrissaNot Available131C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseG6PDNiceNot Available1380G>CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKamiube, KeelungNot Available1387C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNeapolisNot Available1400C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAuresNot Available143T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSplitNot Available1442C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKambosNot Available148C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePalestrinaNot Available170G>AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMetapontoNot Available172G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMusashinoNot Available185C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAsahiNot Available202G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseA- (202), Ferrara INot Available202G->A / 376A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMurcia OristanoNot Available209A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseUbe KonanNot Available241C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLagosantoNot Available242G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseGuangzhouNot Available274C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHammersmithNot Available323T->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSinnaiNot Available34G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseA- (680)Not Available376A->G / 680G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseA- (968), Betica,Selma, GuantanamoNot Available376A->G / 968T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSalerno PyrgosNot Available383T>GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseQuing YanNot Available392G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLagesNot Available40G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseIleshaNot Available466G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMahidolNot Available487G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMalagaNot Available542A->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSibariNot Available634A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMexico CityNot Available680G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNanningNot Available703C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSeattle, Lodi, Modena, Ferrara II, Athens-likeNot Available844G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBajo MaumereNot Available844G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMontalbanoNot Available854G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKalyan-Kerala, Jamnaga, RohiniNot Available949G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseGaoheNot Available95A->GADR InferredIncreased risk of hemolytic anemia.Details
Cytochrome P450 2C9CYP2C9*6Not Available818delAEffect InferredPoor drug metabolizer, lower dose requirementsDetails
Cytochrome P450 2C9CYP2C9*15Not Available485C>AEffect InferredPoor drug metabolizer, lower dose requirementsDetails
Cytochrome P450 2C9CYP2C9*25Not Available353_362delAGAAATGGAAEffect InferredPoor drug metabolizer, lower dose requirementsDetails
Cytochrome P450 2C9CYP2C9*35Not Available374G>T / 430C>TEffect InferredPoor drug metabolizer, lower dose requirementsDetails
Cytochrome P450 2C9CYP2C9*2Not Available430C>TEffect InferredPoor drug metabolizer, lower dose requirementsDetails
Cytochrome P450 2C9CYP2C9*4Not Available1076T>CEffect InferredPoor drug metabolizer, lower dose requirementsDetails
Cytochrome P450 2C9CYP2C9*5Not Available1080C>GEffect InferredPoor drug metabolizer, lower dose requirementsDetails
Cytochrome P450 2C9CYP2C9*8Not Available449G>AEffect InferredPoor drug metabolizer, lower dose requirementsDetails
Cytochrome P450 2C9CYP2C9*11Not Available1003C>TEffect InferredPoor drug metabolizer, lower dose requirementsDetails
Cytochrome P450 2C9CYP2C9*12Not Available1465C>TEffect InferredPoor drug metabolizer, lower dose requirementsDetails
Cytochrome P450 2C9CYP2C9*13Not Available269T>CEffect InferredPoor drug metabolizer, lower dose requirementsDetails
Cytochrome P450 2C9CYP2C9*14Not Available374G>AEffect InferredPoor drug metabolizer, lower dose requirementsDetails
Cytochrome P450 2C9CYP2C9*16Not Available895A>GEffect InferredPoor drug metabolizer, lower dose requirementsDetails
Cytochrome P450 2C9CYP2C9*18Not Available1075A>C / 1190A>C  … show all Effect InferredPoor drug metabolizer, lower dose requirementsDetails
Cytochrome P450 2C9CYP2C9*26Not Available389C>GEffect InferredPoor drug metabolizer, lower dose requirementsDetails
Cytochrome P450 2C9CYP2C9*28Not Available641A>TEffect InferredPoor drug metabolizer, lower dose requirementsDetails
Cytochrome P450 2C9CYP2C9*30Not Available1429G>AEffect InferredPoor drug metabolizer, lower dose requirementsDetails
Cytochrome P450 2C9CYP2C9*33Not Available395G>AEffect InferredPoor drug metabolizer, lower dose requirementsDetails


Drug Interactions
This information should not be interpreted without the help of a healthcare provider. If you believe you are experiencing an interaction, contact a healthcare provider immediately. The absence of an interaction does not necessarily mean no interactions exist.
AbacavirAbacavir may decrease the excretion rate of Glipizide which could result in a higher serum level.
AbaloparatideThe therapeutic efficacy of Glipizide can be decreased when used in combination with Abaloparatide.
AbataceptThe metabolism of Glipizide can be increased when combined with Abatacept.
AbirateroneThe metabolism of Glipizide can be decreased when combined with Abiraterone.
AcarboseThe risk or severity of hypoglycemia can be increased when Acarbose is combined with Glipizide.
AcebutololThe therapeutic efficacy of Glipizide can be increased when used in combination with Acebutolol.
AceclofenacThe protein binding of Glipizide can be decreased when combined with Aceclofenac.
AcemetacinThe protein binding of Glipizide can be decreased when combined with Acemetacin.
AcenocoumarolThe therapeutic efficacy of Acenocoumarol can be increased when used in combination with Glipizide.
AcetaminophenAcetaminophen may decrease the excretion rate of Glipizide which could result in a higher serum level.
Improve patient outcomes
Build effective decision support tools with the industry’s most comprehensive drug-drug interaction checker.
Learn more
Food Interactions
  • Avoid excessive or chronic alcohol consumption. The risk of hypoglycemia is increased when alcohol is ingested.
  • Take before a meal. Take 30-60 minutes before breakfast.


Comprehensive & structured drug product info
From application numbers to product codes, connect different identifiers through our commercial datasets.
Learn more
Easily connect various identifiers back to our datasets
Learn more
Product Images
International/Other Brands
Aldiab / Digrin / Dipazide / Glibenese (Pfizer) / Glibénèse (Dexo) / Glibetin (Johnson) / Glican / Glidiab / Glipid / Glipin (Swiss Pharm) / Glix (YSP) / Gluco-Rite / Glucolip / Glucozide / Glupitel / Glupizide / Glyde / Glydiazinamide / Melizide / Mindiab (Pfizer) / Minidab / Minidiab (Pfizer) / Minodiab / Napizide / Ozidia / Sucrazide / Zitrol XR (Square)
Brand Name Prescription Products
NameDosageStrengthRouteLabellerMarketing StartMarketing EndRegionImage
GlipizideTablet, extended release5 mg/1OralAndrx Pharmaceuticals, Inc.1984-05-082011-07-01US flag
GlipizideTablet, extended release5 mg/1OralRemedy Repack2011-12-082011-12-21US flag
GlipizideTablet, extended release2.5 mg/1OralAndrx Pharmaceuticals, Inc.1984-05-082009-01-01US flag
GlipizideTablet, extended release10 mg/1OralAndrx Pharmaceuticals, Inc.1984-05-082012-01-01US flag
Glipizide ERTablet, extended release10 mg/1OralCardinal Health1994-04-262010-06-30US flag55154 599220180907 15195 1vbs1y1
Glipizide XLTablet, extended release2.5 mg/1OralCardinal Health1994-04-262014-06-30US flag
Glipizide XLTablet, extended release5 mg/1OralGreenstone LLC1994-04-262009-12-17US flag
Glipizide XLTablet, extended release10 mg/1OralState of Florida DOH Central Pharmacy2009-07-01Not applicableUS flag59762 5033 02 nlmimage10 8015c00e
Glipizide XLTablet, extended release2.5 mg/1OralGreenstone LLC1994-04-262009-12-17US flag
Glipizide XLTablet, extended release2.5 mg/1OralCardinal Health1994-04-262014-10-31US flag55154 053920180913 8702 ammbcg
Generic Prescription Products
NameDosageStrengthRouteLabellerMarketing StartMarketing EndRegionImage
GlipizideTablet10 mg/1Oralbryant ranch prepack1995-04-07Not applicableUS flag
GlipizideTablet5 mg/1OralRemedy Repack2015-04-302016-12-16US flag16729 0139 16 nlmimage10 f03b786b
GlipizideTablet, extended release10 mg/1OralZydus Pharmaceuticals (USA) Inc.2018-07-25Not applicableUS flag
GlipizideTablet5 mg/1OralState of Florida DOH Central Pharmacy2009-07-01Not applicableUS flag53808 025720180907 15195 stnocz
GlipizideTablet5 mg/1OralRpk Pharmaceuticals, Inc.2002-09-25Not applicableUS flag
GlipizideTablet10 mg/1OralPD-Rx Pharmaceuticals, Inc.1995-04-072018-12-14US flag
GlipizideTablet10 mg/1OralNcs Health Care Of Ky, Inc Dba Vangard Labs2002-09-25Not applicableUS flag
GlipizideTablet, film coated, extended release5 mg/1OralPar Pharmaceutical, Inc.2016-12-21Not applicableUS flag
GlipizideTablet, extended release2.5 mg/1OralAurobindo Pharma Limited2017-05-122020-08-31US flag
GlipizideTablet5 mg/1OralLegacy Pharmaceutical Packaging1995-04-072019-03-31US flag00781 1452 01 nlmimage10 d720ebf7
Over the Counter Products
NameDosageStrengthRouteLabellerMarketing StartMarketing EndRegionImage
ไกลโคเดียบTablet5 mgOralบริษัท ซีฟาม จำกัด จำกัด2000-10-302020-08-30Thailand flag
Mixture Products
NameIngredientsDosageRouteLabellerMarketing StartMarketing EndRegionImage
Glipizide and Metformin HClGlipizide (2.5 mg/1) + Metformin hydrochloride (250 mg/1)Tablet, film coatedOralREMEDYREPACK INC.2019-07-09Not applicableUS flag
Glipizide and Metformin HClGlipizide (2.5 mg/1) + Metformin hydrochloride (500 mg/1)Tablet, film coatedOralRemedy Repack2013-10-312014-10-31US flag23155 0116 01 nlmimage10 bd3b5e8a
Glipizide and Metformin HClGlipizide (2.5 mg/1) + Metformin hydrochloride (250 mg/1)Tablet, film coatedOralHeritage Pharmaceuticals Inc. d/b/a Avet Pharmaceuticals Inc.2010-06-29Not applicableUS flag
Glipizide and Metformin HClGlipizide (5 mg/1) + Metformin hydrochloride (500 mg/1)Tablet, film coatedOralREMEDYREPACK INC.2018-10-26Not applicableUS flag
Glipizide and Metformin HClGlipizide (5 mg/1) + Metformin hydrochloride (500 mg/1)Tablet, film coatedOralRemedy Repack2013-10-312016-08-25US flag23155 0117 01 nlmimage10 2c461610
Glipizide and Metformin HClGlipizide (5 mg/1) + Metformin hydrochloride (500 mg/1)Tablet, film coatedOralHeritage Pharmaceuticals Inc. d/b/a Avet Pharmaceuticals Inc.2010-06-29Not applicableUS flag
Glipizide and Metformin HClGlipizide (5 mg/1) + Metformin hydrochloride (500 mg/1)Tablet, film coatedOralA-S Medication Solutions2010-06-29Not applicableUS flag50090 108220180907 15195 1ig7fy5
Glipizide and Metformin HClGlipizide (5 mg/1) + Metformin hydrochloride (500 mg/1)Tablet, film coatedOralProficient Rx LP2010-06-29Not applicableUS flag
Glipizide and Metformin HClGlipizide (2.5 mg/1) + Metformin hydrochloride (250 mg/1)Tablet, film coatedOralLake Erie Medical Dba Quality Care Produts Llc2010-06-292014-12-31US flag
Glipizide and Metformin HClGlipizide (2.5 mg/1) + Metformin hydrochloride (500 mg/1)Tablet, film coatedOralHeritage Pharmaceuticals Inc. d/b/a Avet Pharmaceuticals Inc.2010-06-29Not applicableUS flag


ATC Codes
A10BB07 — Glipizide
Drug Categories
Chemical TaxonomyProvided by Classyfire
This compound belongs to the class of organic compounds known as benzenesulfonamides. These are organic compounds containing a sulfonamide group that is S-linked to a benzene ring.
Organic compounds
Super Class
Benzene and substituted derivatives
Sub Class
Direct Parent
Alternative Parents
Benzenesulfonyl compounds / Sulfonylureas / Pyrazines / Organosulfonic acids and derivatives / Heteroaromatic compounds / Aminosulfonyl compounds / Propargyl-type 1,3-dipolar organic compounds / Carboximidic acids / Azacyclic compounds / Organopnictogen compounds
show 3 more
Aminosulfonyl compound / Aromatic heteromonocyclic compound / Azacycle / Benzenesulfonamide / Benzenesulfonyl group / Carboximidic acid / Carboximidic acid derivative / Heteroaromatic compound / Hydrocarbon derivative / Organic 1,3-dipolar compound
show 14 more
Molecular Framework
Aromatic heteromonocyclic compounds
External Descriptors
pyrazines, monocarboxylic acid amide, aromatic amide, N-sulfonylurea (CHEBI:5384)
Affected organisms
  • Humans and other mammals

Chemical Identifiers

CAS number
InChI Key


Synthesis Reference

Suresh Kumar Gidwani, Purushottam Singnurkar, Prashant Kumar Tewari, "Sustained release pharmaceutical composition containing glipizide and method for producing same." U.S. Patent US6270797, issued February, 2000.

General References
  1. Melander A, Wahlin-Boll E: Clinical pharmacology of glipizide. Am J Med. 1983 Nov 30;75(5B):41-5. [Article]
  2. Skillman TG, Feldman JM: The pharmacology of sulfonylureas. Am J Med. 1981 Feb;70(2):361-72. [Article]
  3. Quianzon CC, Cheikh IE: History of current non-insulin medications for diabetes mellitus. J Community Hosp Intern Med Perspect. 2012 Oct 15;2(3). pii: 19081. doi: 10.3402/jchimp.v2i3.19081. Print 2012. [Article]
  4. Sola D, Rossi L, Schianca GP, Maffioli P, Bigliocca M, Mella R, Corliano F, Fra GP, Bartoli E, Derosa G: Sulfonylureas and their use in clinical practice. Arch Med Sci. 2015 Aug 12;11(4):840-8. doi: 10.5114/aoms.2015.53304. Epub 2015 Aug 11. [Article]
  5. Olokoba AB, Obateru OA, Olokoba LB: Type 2 diabetes mellitus: a review of current trends. Oman Med J. 2012 Jul;27(4):269-73. doi: 10.5001/omj.2012.68. [Article]
  6. 30. (2012). In Rang and Dale's Pharmacology (7th ed., pp. 380-381, 383). Edinburgh: Elsevier/Churchill Livingstone. [ISBN:978-0-7020-3471-8]
  7. Clinical Practice Guidelines - 2018 Full Guidelines - Diabetes Canada - Chapter 13: Pharmacologic Glycemic Management of Type 2 Diabetes in Adults [Link]
  8. Glipizide - StatPearls - NCBI Bookshelf [Link]
  9. Glipizide 5 mg Tablets - Summary of Product Characteristics (SmPC) - European Medicines Agency [Link]
  10. Glucotrol (Glipizide) FDA Label [Link]
  11. GLUCOTROL XL® (glipizide) extended release tablets - FDA Label [Link]
  12. METAGLIP (glipizide and metformin HCl) Tablets - FDA Label [Link]
Human Metabolome Database
PubChem Compound
PubChem Substance
Therapeutic Targets Database
RxList Drug Page Drug Page
PDRhealth Drug Page
FDA label
Download (66.9 KB)
Download (22.4 KB)

Clinical Trials

Clinical Trials
4CompletedTreatmentCoronary Artery Disease (CAD) / Type 2 Diabetes Mellitus1
4CompletedTreatmentType 2 Diabetes Mellitus3
4Enrolling by InvitationTreatmentChildhood Diabetes Mellitus / Maturity Onset Diabetes of the Young, Type 1 / Maturity-Onset Diabetes of the Young, Type 3 / Type 1 Diabetes Mellitus1
4Not Yet RecruitingBasic ScienceAtherosclerosis / Cardiovascular Disease (CVD) / Insulin Resistance / Type 2 Diabetes Mellitus1
4RecruitingTreatmentType 2 Diabetes Mellitus1
4Unknown StatusBasic ScienceType 2 Diabetes Mellitus1
4Unknown StatusTreatmentSevere Hyperglycemia - Blood Glucose Level >300mg/dl / Type 2 Diabetes Mellitus1
3CompletedTreatmentDiabetes Mellitus1
3CompletedTreatmentEnd Stage Renal Disease (ESRD) / Type 2 Diabetes Mellitus1


Not Available
  • Actavis Group
  • Advanced Pharmaceutical Services Inc.
  • Alphapharm Party Ltd.
  • Amerisource Health Services Corp.
  • Apotex Inc.
  • Apotheca Inc.
  • AQ Pharmaceuticals Inc.
  • A-S Medication Solutions LLC
  • Atlantic Biologicals Corporation
  • Bristol-Myers Squibb Co.
  • Bryant Ranch Prepack
  • Caraco Pharmaceutical Labs
  • Cardinal Health
  • Coupler Enterprises Inc.
  • Dept Health Central Pharmacy
  • Direct Dispensing Inc.
  • Dispensing Solutions
  • Diversified Healthcare Services Inc.
  • Duramed
  • Goldline Laboratories Inc.
  • Greenstone LLC
  • Heartland Repack Services LLC
  • Ivax Pharmaceuticals
  • Kaiser Foundation Hospital
  • Lake Erie Medical and Surgical Supply
  • Legacy Pharmaceuticals Packaging LLC
  • Liberty Pharmaceuticals
  • Major Pharmaceuticals
  • Mckesson Corp.
  • Medisca Inc.
  • Medvantx Inc.
  • Murfreesboro Pharmaceutical Nursing Supply
  • Mylan
  • Novopharm Ltd.
  • Nucare Pharmaceuticals Inc.
  • Palmetto Pharmaceuticals Inc.
  • Patheon Inc.
  • PD-Rx Pharmaceuticals Inc.
  • Pfizer Inc.
  • Pharmaceutical Utilization Management Program VA Inc.
  • Pharmacy Service Center
  • Pharmedix
  • Physicians Total Care Inc.
  • Pratt Pharmaceuticals
  • Preferred Pharmaceuticals Inc.
  • Prepackage Specialists
  • Prepak Systems Inc.
  • Qualitest
  • Rebel Distributors Corp.
  • Remedy Repack
  • Resource Optimization and Innovation LLC
  • Sandhills Packaging Inc.
  • Sandoz
  • Southwood Pharmaceuticals
  • Stat Rx Usa
  • Stat Scripts LLC
  • Teva Pharmaceutical Industries Ltd.
  • Torpharm Inc.
  • UDL Laboratories
  • United Research Laboratories Inc.
  • US Pharmaceutical Group
  • Va Cmop Dallas
  • Vangard Labs Inc.
  • Watson Pharmaceuticals
Dosage Forms
TabletOral10 mg/1
TabletOral5 mg/1
Tablet, film coated, extended releaseOral10 mg/1
Tablet, film coated, extended releaseOral2.5 mg/1
Tablet, film coated, extended releaseOral5 mg/1
Tablet, coatedOral
Tablet, extended releaseOral10 mg/1
Tablet, extended releaseOral5 mg/1
TabletOral10 mg
Tablet, extended releaseOral
Tablet, extended releaseOral2.5 mg/1
Tablet, extended releaseOral21.94 mg
Tablet, film coatedOral
TabletOral5 mg
Tablet, coatedOral5 mg
Unit descriptionCostUnit
Glipizide powder36.11USD g
Glucotrol XL 10 mg 24 Hour tablet1.53USD tablet
Glucotrol xl 10 mg tablet1.37USD tablet
Metaglip 5-500 mg tablet1.33USD tablet
Metaglip 2.5-500 mg tablet1.32USD tablet
Metaglip 2.5-250 mg tablet1.2USD tablet
Glucotrol 10 mg tablet1.19USD tablet
Glucotrol XL 2.5 mg 24 Hour tablet0.99USD tablet
Glucotrol XL 5 mg 24 Hour tablet0.99USD tablet
GlipiZIDE XL 10 mg 24 Hour tablet0.84USD tablet
Glucotrol 5 mg tablet0.69USD tablet
Glucotrol xl 2.5 mg tablet0.69USD tablet
Glucotrol xl 5 mg tablet0.69USD tablet
Glipizide 10 mg tablet0.67USD tablet
GlipiZIDE XL 2.5 mg 24 Hour tablet0.63USD tablet
GlipiZIDE XL 5 mg 24 Hour tablet0.5USD tablet
Glipizide 5 mg tablet0.36USD tablet
DrugBank does not sell nor buy drugs. Pricing information is supplied for informational purposes only.
Patent NumberPediatric ExtensionApprovedExpires (estimated)Region
US5591454No1997-01-072014-01-07US flag
US5024843No1991-06-182009-09-05US flag
CA2024502No1997-11-112010-08-31Canada flag
USRE44459No2013-08-272019-03-26US flag


Experimental Properties
melting point (°C)200-203U.S. Patent 3,669,966.
water solubility37.2 mg/LNot Available
logP1.91HANSCH,C ET AL. (1995)
pKa5.9PANTEN,U ET AL. (1989)
Predicted Properties
Water Solubility0.0164 mg/mLALOGPS
pKa (Strongest Acidic)4.32ChemAxon
pKa (Strongest Basic)0.061ChemAxon
Physiological Charge-1ChemAxon
Hydrogen Acceptor Count6ChemAxon
Hydrogen Donor Count3ChemAxon
Polar Surface Area130.15 Å2ChemAxon
Rotatable Bond Count6ChemAxon
Refractivity115.62 m3·mol-1ChemAxon
Polarizability47.62 Å3ChemAxon
Number of Rings3ChemAxon
Rule of FiveYesChemAxon
Ghose FilterYesChemAxon
Veber's RuleNoChemAxon
MDDR-like RuleYesChemAxon
Predicted ADMET Features
Human Intestinal Absorption+0.9262
Blood Brain Barrier+0.5599
Caco-2 permeable-0.7025
P-glycoprotein substrateSubstrate0.5326
P-glycoprotein inhibitor INon-inhibitor0.7469
P-glycoprotein inhibitor IINon-inhibitor0.9302
Renal organic cation transporterNon-inhibitor0.8322
CYP450 2C9 substrateSubstrate0.5731
CYP450 2D6 substrateNon-substrate0.9116
CYP450 3A4 substrateNon-substrate0.719
CYP450 1A2 substrateNon-inhibitor0.9501
CYP450 2C9 inhibitorInhibitor0.8949
CYP450 2D6 inhibitorNon-inhibitor0.9231
CYP450 2C19 inhibitorNon-inhibitor0.9025
CYP450 3A4 inhibitorNon-inhibitor0.8309
CYP450 inhibitory promiscuityLow CYP Inhibitory Promiscuity0.8682
Ames testNon AMES toxic0.7745
BiodegradationNot ready biodegradable0.9703
Rat acute toxicity2.1662 LD50, mol/kg Not applicable
hERG inhibition (predictor I)Weak inhibitor0.9118
hERG inhibition (predictor II)Non-inhibitor0.8539
ADMET data is predicted using admetSAR, a free tool for evaluating chemical ADMET properties. (23092397)


Mass Spec (NIST)
Not Available
SpectrumSpectrum TypeSplash Key
Predicted GC-MS Spectrum - GC-MSPredicted GC-MSNot Available
Predicted MS/MS Spectrum - 10V, Positive (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 20V, Positive (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 40V, Positive (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 10V, Negative (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 20V, Negative (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 40V, Negative (Annotated)Predicted LC-MS/MSNot Available
LC-MS/MS Spectrum - LC-ESI-qTof , PositiveLC-MS/MSNot Available
LC-MS/MS Spectrum - LC-ESI-qTof , PositiveLC-MS/MSNot Available
LC-MS/MS Spectrum - LC-ESI-qTof , PositiveLC-MS/MSNot Available
MS/MS Spectrum - , positiveLC-MS/MSsplash10-014i-0009600000-3a2ab7e8e725ab4b2090
MS/MS Spectrum - , positiveLC-MS/MSsplash10-00di-0329000000-a6f7044e9dfe397cfcdd
MS/MS Spectrum - , positiveLC-MS/MSsplash10-014i-0119600000-895a0f8ef34678f1200d
MS/MS Spectrum - , positiveLC-MS/MSsplash10-00di-1429000000-60bdb648d5355af7a75b
MS/MS Spectrum - , positiveLC-MS/MSsplash10-0v4i-3941000000-57ab7532afaad5f9a2ac


Accelerate your drug discovery research
with our fully connected ADMET & drug target dataset.
Learn more
Accelerate your drug discovery research with our ADMET & drug target dataset
Learn more
Pharmacological action
General Function
Sulfonylurea receptor activity
Specific Function
Subunit of the beta-cell ATP-sensitive potassium channel (KATP). Regulator of ATP-sensitive K(+) channels and insulin release.
Gene Name
Uniprot ID
Uniprot Name
ATP-binding cassette sub-family C member 8
Molecular Weight
176990.36 Da
  1. Gribble FM, Ashcroft FM: Sulfonylurea sensitivity of adenosine triphosphate-sensitive potassium channels from beta cells and extrapancreatic tissues. Metabolism. 2000 Oct;49(10 Suppl 2):3-6. [Article]
  2. Harrower A: Gliclazide modified release: from once-daily administration to 24-hour blood glucose control. Metabolism. 2000 Oct;49(10 Suppl 2):7-11. [Article]
  3. Lawrence CL, Proks P, Rodrigo GC, Jones P, Hayabuchi Y, Standen NB, Ashcroft FM: Gliclazide produces high-affinity block of KATP channels in mouse isolated pancreatic beta cells but not rat heart or arterial smooth muscle cells. Diabetologia. 2001 Aug;44(8):1019-25. [Article]
  4. Reimann F, Ashcroft FM, Gribble FM: Structural basis for the interference between nicorandil and sulfonylurea action. Diabetes. 2001 Oct;50(10):2253-9. [Article]
  5. Proks P, Reimann F, Green N, Gribble F, Ashcroft F: Sulfonylurea stimulation of insulin secretion. Diabetes. 2002 Dec;51 Suppl 3:S368-76. [Article]
Pharmacological action
General Function
Zinc ion binding
Specific Function
Nuclear receptor that binds peroxisome proliferators such as hypolipidemic drugs and fatty acids. Once activated by a ligand, the nuclear receptor binds to DNA specific PPAR response elements (PPRE...
Gene Name
Uniprot ID
Uniprot Name
Peroxisome proliferator-activated receptor gamma
Molecular Weight
57619.58 Da
  1. Scarsi M, Podvinec M, Roth A, Hug H, Kersten S, Albrecht H, Schwede T, Meyer UA, Rucker C: Sulfonylureas and glinides exhibit peroxisome proliferator-activated receptor gamma activity: a combined virtual screening and biological assay approach. Mol Pharmacol. 2007 Feb;71(2):398-406. Epub 2006 Nov 2. [Article]


Pharmacological action
General Function
Steroid hydroxylase activity
Specific Function
Cytochromes P450 are a group of heme-thiolate monooxygenases. In liver microsomes, this enzyme is involved in an NADPH-dependent electron transport pathway. It oxidizes a variety of structurally un...
Gene Name
Uniprot ID
Uniprot Name
Cytochrome P450 2C9
Molecular Weight
55627.365 Da
  1. Zhou SF, Zhou ZW, Yang LP, Cai JP: Substrates, inducers, inhibitors and structure-activity relationships of human Cytochrome P450 2C9 and implications in drug development. Curr Med Chem. 2009;16(27):3480-675. Epub 2009 Sep 1. [Article]
  2. Flockhart Table of Drug Interactions [Link]
Pharmacological action
General Function
Steroid binding
Specific Function
UDPGT is of major importance in the conjugation and subsequent elimination of potentially toxic xenobiotics and endogenous compounds. This isoform glucuronidates bilirubin IX-alpha to form both the...
Gene Name
Uniprot ID
Uniprot Name
UDP-glucuronosyltransferase 1-1
Molecular Weight
59590.91 Da
  1. Williams JA, Hyland R, Jones BC, Smith DA, Hurst S, Goosen TC, Peterkin V, Koup JR, Ball SE: Drug-drug interactions for UDP-glucuronosyltransferase substrates: a pharmacokinetic explanation for typically observed low exposure (AUCi/AUC) ratios. Drug Metab Dispos. 2004 Nov;32(11):1201-8. doi: 10.1124/dmd.104.000794. Epub 2004 Aug 10. [Article]


Pharmacological action
General Function
Toxic substance binding
Specific Function
Serum albumin, the main protein of plasma, has a good binding capacity for water, Ca(2+), Na(+), K(+), fatty acids, hormones, bilirubin and drugs. Its main function is the regulation of the colloid...
Gene Name
Uniprot ID
Uniprot Name
Serum albumin
Molecular Weight
69365.94 Da


Pharmacological action
General Function
Transporter activity
Specific Function
Involved in the ATP-dependent secretion of bile salts into the canaliculus of hepatocytes.
Gene Name
Uniprot ID
Uniprot Name
Bile salt export pump
Molecular Weight
146405.83 Da
  1. Pedersen JM, Matsson P, Bergstrom CA, Hoogstraate J, Noren A, LeCluyse EL, Artursson P: Early identification of clinically relevant drug interactions with the human bile salt export pump (BSEP/ABCB11). Toxicol Sci. 2013 Dec;136(2):328-43. doi: 10.1093/toxsci/kft197. Epub 2013 Sep 6. [Article]

Drug created on June 13, 2005 13:24 / Updated on May 07, 2021 21:21