

Nitrous acid is an iron binder used to reverse life-threatening acute cyanide poisoning.

Brand Names
Generic Name
Nitrous acid
DrugBank Accession Number

Nitrous acid (as sodium nitrite) is used as part of an intravenous mixture with sodium thiosulfate to treat cyanide poisoning. It is on the World Health Organization's List of Essential Medicines, a list of the most important medications needed in a basic health system. There is also research to investigate its applicability towards treatments for heart attacks, brain aneurysms, pulmonary hypertension in infants, and Pseudomonas aeruginosa infections.

Small Molecule
Approved, Investigational
Average: 47.0134
Monoisotopic: 47.000728281
Chemical Formula
  • dioxonitric acid
  • hydroxidooxidonitrogen
  • nitrosyl hydroxide



For sequential use with sodium thiosulfate for the treatment of acute cyanide poisoning that is judged to be life-threatening Label.

Reduce drug development failure rates
Build, train, & validate machine-learning models
with evidence-based and structured datasets.
See how
Build, train, & validate predictive machine-learning models with structured datasets.
See how
Associated Conditions
Contraindications & Blackbox Warnings
Avoid life-threatening adverse drug events
Improve clinical decision support with information on contraindications & blackbox warnings, population restrictions, harmful risks, & more.
Learn more
Avoid life-threatening adverse drug events & improve clinical decision support.
Learn more

Sodium nitrite reverses cyanide toxicity and produces blood vessel dilation 1.

Mechanism of action

Cyanide has a high affinity for the oxidized form of iron (Fe3+) such as that found in cytochrome oxidase a3 2. Cyanide binds to and inhibits cytochrome oxidase a3, preventing oxidative phophorylation from occuring. The resultant lack of ATP cannot support normal cellular processes, particularly in the brain. Compensatory increases in anaerobic respiration result in rising levels of lactic acid and subsequent acidosis.

Nitrite primarily acts by oxidizing hemoglobin to methemoglobin 1. The now oxidized Fe3+ in methemoglobin also binds cyanide with high affinity and accepts cyanide from cytochrome a3. This leaves cytochrome a3 free to resume its function in oxidative phosphorylation. The slow dissociation of cyanide from methemoglobin allows hepatic enzymes such as rhodanese to detoxify the compound without further systemic toxicity occuring. Methemoglobin is reduced back to hemoglobin by methemoglobin reductase allowing the affected blood cells to resume normal functioning.

The reduction of nitrite by hemoglobin results in the formation of nitric oxide 3. Nitric oxide acts as a powerful vasodilator, producing vascular smooth muscle relaxation through activation of soluble guanylate cyclase and the subsequent cyclic guanylyl triphosphate mediated signalling cascade 4.

AHemoglobin subunit alpha
AHemoglobin subunit beta

Not Available

Volume of distribution

Not Available

Protein binding

Not Available


Reduced by deoxyhemoglobin to form nitric oxide 3. Nitrite is also reduced to nitric oxide and further reduced to ammonia by gut bacteria 6. Nitrite can be oxidized to nitrate by oxyhemoglobin.

Hover over products below to view reaction partners

Route of elimination

Not Available


Half life of 0.4-0.78h 5.


Not Available

Adverse Effects
Improve decision support & research outcomes
With structured adverse effects data, including: blackbox warnings, adverse reactions, warning & precautions, & incidence rates.
Learn more
Improve decision support & research outcomes with our structured adverse effects data.
Learn more

Oral LD50 of 157.9mg/kg observed in rats and 175mg/kg observed in mice MSDS. Estimated oral LD50 of 35mg/kg in humans 1. Sodium nitrite toxicity manifests as cardiovascular collapse following severe hypotension due to nitrite's vasodilatory action.

Not Available
Pharmacogenomic Effects/ADRs
Interacting Gene/EnzymeAllele nameGenotype(s)Defining Change(s)Type(s)DescriptionDetails
Glucose-6-phosphate 1-dehydrogenaseVilleurbanneNot Available1000_1002delACCADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseTorunNot Available1006A->GADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseSunderlandNot Available105_107delCATADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseIwatsukiNot Available1081G->AADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseSerresNot Available1082C->TADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseTondelaNot Available1084_1101delCTGAACGAGCGCAAGGCCADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseLoma LindaNot Available1089C->AADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseAachenNot Available1089C->GADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseTenriNot Available1096A->GADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseMontpellierNot Available1132G>AADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseCalvo MackennaNot Available1138A->GADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseRileyNot Available1139T->CADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseOlomoucNot Available1141T->CADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseTomahNot Available1153T->CADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseLynwoodNot Available1154G->TADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseMadridNot Available1155C->GADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseIowa, Walter Reed, SpringfieldNot Available1156A->GADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseBeverly Hills, Genova, Iwate, Niigata, YamaguchiNot Available1160G->AADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseHartfordNot Available1162A->GADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenasePrahaNot Available1166A->GADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseKrakowNot Available1175T>CADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseWisconsinNot Available1177C->GADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseNashville, Anaheim, PorticiNot Available1178G->AADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseAlhambraNot Available1180G->CADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseBariNot Available1187C->TADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenasePuerto LimonNot Available1192G->AADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseCovao do LoboNot Available1205C>AADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseClinicNot Available1215G->AADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseUtrechtNot Available1225C->TADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseSuwalkiNot Available1226C->GADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseRiversideNot Available1228G->TADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseJapan, ShinagawaNot Available1229G->AADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseKawasakiNot Available1229G->CADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseMunichNot Available1231A->GADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseGeorgiaNot Available1284C->AADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseSumareNot Available1292T->GADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseTelti/KobeNot Available1318C->TADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseSantiago de Cuba, MoriokaNot Available1339G->AADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseHarimaNot Available1358T->AADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseFiguera da FozNot Available1366G->CADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseAmiensNot Available1367A>TADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseBangkok NoiNot Available1376G->T, 1502T->GADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseFukayaNot Available1462G->AADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseCampinasNot Available1463G->TADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseBuenos AiresNot Available1465C>TADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseArakawaNot Available1466C->TADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseBrightonNot Available1488_1490delGAAADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseKozukataNot Available159G->CADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseAmsterdamNot Available180_182delTCTADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseNo nameNot Available202G->A, 376A->G, 1264C>GADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseSwanseaNot Available224T->CADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseUrayasuNot Available281_283delAGAADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseVancouverNot Available317C->G544C->T592C->TADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseMt SinaiNot Available376A->G, 1159C->TADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenasePlymouthNot Available488G->AADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseVolendamNot Available514C->TADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseShinshuNot Available527A->GADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseChikugoNot Available535A->TADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseTsukuiNot Available561_563delCTCADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenasePedoplis-CkaroNot Available573C>GADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseSantiagoNot Available593G->CADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseMinnesota, Marion, Gastonia, LeJeuneNot Available637G->TADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseCincinnatiNot Available637G->T, 1037A->TADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseHarilaouNot Available648T->GADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseNorth DallasNot Available683_685delACAADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseAsahikawaNot Available695G->AADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseDurhamNot Available713A->GADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseStonybrookNot Available724_729delGGCACTADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseWayneNot Available769C->GADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseAveiroNot Available806G->AADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseCleveland CorumNot Available820G->AADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseLilleNot Available821A>TADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseBangkokNot Available825G>CADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseSugaoNot Available826C->TADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseLa JollaNot Available832T->CADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseWexhamNot Available833C->TADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenasePiotrkowNot Available851T>CADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseWest VirginiaNot Available910G->TADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseOmiyaNot Available921G->CADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseNaraNot Available953_976delCCACCAAAGGGTACCTGGAC GACCADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseManhattanNot Available962G->AADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseRehevotNot Available964T->CADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseHoniaraNot Available99A->G / 1360C->TADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseTokyo, FukushimaNot Available1246G->AADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseChathamNot Available1003G->AADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseFushanNot Available1004C->AADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenasePartenopeNot Available1052G->TADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseIerapetraNot Available1057C->TADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseAnadiaNot Available1193A->GADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseAbenoNot Available1220A->CADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseSurabayaNot Available1291G->AADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenasePawneeNot Available1316G->CADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseS. AntiocoNot Available1342A->GADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseCassanoNot Available1347G->CADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseHermoupolisNot Available1347G->C / 1360C->TADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseUnion,Maewo, Chinese-2, KaloNot Available1360C->TADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseAndalusNot Available1361G->AADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseCosenzaNot Available1376G->CADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseCanton, Taiwan- Hakka, Gifu-like, Agrigento-likeNot Available1376G->TADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseFloresNot Available1387C->AADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseKaiping, Anant, Dhon, Sapporo-like, WoseraNot Available1388G->AADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseKamogawaNot Available169C->TADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseCostanzoNot Available179T>CADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseAmazoniaNot Available185C->AADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseSongklanagarindNot Available196T->AADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseHechiNot Available202G->A / 871G->AADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseNamouruNot Available208T->CADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseBao LocNot Available352T>CADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseCrispimNot Available375G->T, 379G->T383T->C384C>TADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseAcrokorinthosNot Available376A->G / 463C->GADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseSanta MariaNot Available376A->G / 542A->TADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseAnanindeuaNot Available376A->G / 871G->AADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseVanua LavaNot Available383T->CADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseValladolidNot Available406C->TADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseBelemNot Available409C->TADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseLiuzhouNot Available442G->AADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseShenzenNot Available473G>AADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseTaipei “Chinese- 3”Not Available493A->GADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseToledoNot Available496C>TADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseNaoneNot Available497G->AADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseNankangNot Available517T->CADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseMiaoliNot Available519C->GADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseMediterranean, Dallas, Panama‚ Sassari, Cagliari, BirminghamNot Available563C->TADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseCoimbra ShundeNot Available592C->TADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseNilgiriNot Available593G>AADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseRadlowoNot Available679C->TADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseRoubaixNot Available811G>CADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseHaikouNot Available835A->GADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseChinese-1Not Available835A->TADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseMizushimaNot Available848A>GADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseOsakaNot Available853C->TADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseViangchan, JammuNot Available871G->AADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseSeoulNot Available916G->AADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseLudhianaNot Available929G->AADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseFarroupilhaNot Available977C->AADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseChinese-5Not Available1024C->TADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseRignanoNot Available130G>AADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseOrissaNot Available131C->GADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseG6PDNiceNot Available1380G>CADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseKamiube, KeelungNot Available1387C->TADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseNeapolisNot Available1400C->GADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseAuresNot Available143T->CADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseSplitNot Available1442C->GADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseKambosNot Available148C->TADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenasePalestrinaNot Available170G>AADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseMetapontoNot Available172G->AADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseMusashinoNot Available185C->TADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseAsahiNot Available202G->AADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseA- (202), Ferrara INot Available202G->A / 376A->GADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseMurcia OristanoNot Available209A->GADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseUbe KonanNot Available241C->TADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseLagosantoNot Available242G->AADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseGuangzhouNot Available274C->TADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseHammersmithNot Available323T->AADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseSinnaiNot Available34G->TADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseA- (680)Not Available376A->G / 680G->TADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseA- (968), Betica,Selma, GuantanamoNot Available376A->G / 968T->CADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseSalerno PyrgosNot Available383T>GADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseQuing YanNot Available392G->TADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseLagesNot Available40G->AADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseIleshaNot Available466G->AADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseMahidolNot Available487G->AADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseMalagaNot Available542A->TADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseSibariNot Available634A->GADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseMexico CityNot Available680G->AADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseNanningNot Available703C->TADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseSeattle, Lodi, Modena, Ferrara II, Athens-likeNot Available844G->CADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseBajo MaumereNot Available844G->TADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseMontalbanoNot Available854G->AADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseKalyan-Kerala, Jamnaga, RohiniNot Available949G->AADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseGaoheNot Available95A->GADR InferredIncreased risk of hemolytic crisis.Details


Drug Interactions
This information should not be interpreted without the help of a healthcare provider. If you believe you are experiencing an interaction, contact a healthcare provider immediately. The absence of an interaction does not necessarily mean no interactions exist.
AcebutololThe risk or severity of adverse effects can be increased when Acebutolol is combined with Nitrous acid.
AldesleukinThe risk or severity of adverse effects can be increased when Aldesleukin is combined with Nitrous acid.
AliskirenThe risk or severity of adverse effects can be increased when Aliskiren is combined with Nitrous acid.
AmbrisentanNitrous acid may increase the hypotensive activities of Ambrisentan.
AmifostineThe risk or severity of adverse effects can be increased when Amifostine is combined with Nitrous acid.
AmilorideThe risk or severity of adverse effects can be increased when Amiloride is combined with Nitrous acid.
AmiodaroneThe risk or severity of adverse effects can be increased when Amiodarone is combined with Nitrous acid.
AmlodipineThe risk or severity of adverse effects can be increased when Amlodipine is combined with Nitrous acid.
AmobarbitalAmobarbital may increase the hypotensive activities of Nitrous acid.
Amphotericin BThe risk or severity of adverse effects can be increased when Amphotericin B is combined with Nitrous acid.
Identify potential medication risks
Easily compare up to 40 drugs with our drug interaction checker.
Get severity rating, description, and management advice.
Learn more
Food Interactions
No interactions found.


Drug product information from 10+ global regions
Our datasets provide approved product information including:
dosage, form, labeller, route of administration, and marketing period.
Access now
Access drug product information from over 10 global regions.
Access now
Product Ingredients
IngredientUNIICASInChI Key
Potassium nitrite794654G42LNot AvailableNot applicable
Active Moieties
Brand Name Prescription Products
NameDosageStrengthRouteLabellerMarketing StartMarketing EndRegionImage
Sodium NitriteInjection, solution30 mg/1mLIntravenousHope Pharmaceuticals2012-02-14Not applicableUS flag
Sodium Nitrite Injection, USPSolution30 mg / mLIntravenousHope Pharmaceuticals2016-07-20Not applicableCanada flag
Mixture Products
NameIngredientsDosageRouteLabellerMarketing StartMarketing EndRegionImage
CVS Pharmacy Enamel GuardPotassium nitrite (5 g/100g) + Sodium fluoride (0.15 g/100g)Paste, dentifriceDentalCVS PHARMACY2012-10-01Not applicableUS flag
NithiodoteSodium nitrite (30 mg/1mL) + Sodium thiosulfate pentahydrate (250 mg/1mL)Injection, solution; KitIntravenousHope Pharmaceuticals2011-01-14Not applicableUS flag
Rite Aid Enamel GuardPotassium nitrite (5 g/100g) + Sodium fluoride (0.15 g/100g)Paste, dentifriceDentalRite Aid2013-06-03Not applicableUS flag
Wakefern Enamel GuardPotassium nitrite (5 g/100g) + Sodium fluoride (0.15 g/100g)Paste, dentifriceDentalWakefern2014-02-032019-03-01US flag


ATC Codes
V03AB08 — Sodium nitrite
Drug Categories
Not classified
Affected organisms
Not Available

Chemical Identifiers

CAS number
InChI Key
nitrous acid


General References
  1. Baskin SI, Horowitz AM, Nealley EW: The antidotal action of sodium nitrite and sodium thiosulfate against cyanide poisoning. J Clin Pharmacol. 1992 Apr;32(4):368-75. [Article]
  2. Beasley DM, Glass WI: Cyanide poisoning: pathophysiology and treatment recommendations. Occup Med (Lond). 1998 Oct;48(7):427-31. [Article]
  3. Lundberg JO, Weitzberg E, Gladwin MT: The nitrate-nitrite-nitric oxide pathway in physiology and therapeutics. Nat Rev Drug Discov. 2008 Feb;7(2):156-67. doi: 10.1038/nrd2466. [Article]
  4. Denninger JW, Marletta MA: Guanylate cyclase and the .NO/cGMP signaling pathway. Biochim Biophys Acta. 1999 May 5;1411(2-3):334-50. [Article]
  5. Rix PJ, Vick A, Attkins NJ, Barker GE, Bott AW, Alcorn H Jr, Gladwin MT, Shiva S, Bradley S, Hussaini A, Hoye WL, Parsley EL, Masamune H: Pharmacokinetics, pharmacodynamics, safety, and tolerability of nebulized sodium nitrite (AIR001) following repeat-dose inhalation in healthy subjects. Clin Pharmacokinet. 2015 Mar;54(3):261-72. doi: 10.1007/s40262-014-0201-y. [Article]
  6. Tiso M, Schechter AN: Nitrate reduction to nitrite, nitric oxide and ammonia by gut bacteria under physiological conditions. PLoS One. 2015 Mar 24;10(3):e0119712. doi: 10.1371/journal.pone.0119712. eCollection 2015. [Article]
KEGG Compound
PubChem Compound
PubChem Substance
FDA label
Download (250 KB)
Download (105 KB)

Clinical Trials

Clinical Trials
3WithdrawnPreventionAcute Kidney Injury (AKI)1
2Active Not RecruitingTreatmentHeart Failure / Pulmonary Hypertension Secondary1
2CompletedDiagnosticHeart Failure1
2CompletedTreatmentAcute Myocardial Infarction (AMI)1
2CompletedTreatmentCardiovascular Disease (CVD) / Myocardial Infarction / Myocardial Ischemia / Reperfusion Injury1
2CompletedTreatmentChronic Kidney Disease (CKD)1
2CompletedTreatmentEndothelium-Derived Relaxing Factor / Healthy Subjects (HS) / Nitric Oxide1
2CompletedTreatmentHeart Failure4


Not Available
Not Available
Dosage Forms
Paste, dentifriceDental
Injection, solution; kitIntravenous
Injection, solutionIntravenous30 mg/1mL
SolutionIntravenous30 mg / mL
Not Available
Patent NumberPediatric ExtensionApprovedExpires (estimated)Region
US8496973No2013-07-302031-03-29US flag
US8568793No2013-10-292031-12-24US flag
US9585912No2017-03-072031-03-29US flag
US9345724No2016-05-242031-03-29US flag
US9687506No2011-12-242031-12-24US flag
US10479686No2011-03-292031-03-29US flag


Experimental Properties
melting point (°C)271MSDS
boiling point (°C)320MSDS
water solubility820g/LMSDS
Predicted Properties
pKa (Strongest Basic)-3.5ChemAxon
Physiological Charge0ChemAxon
Hydrogen Acceptor Count3ChemAxon
Hydrogen Donor Count1ChemAxon
Polar Surface Area49.66 Å2ChemAxon
Rotatable Bond Count0ChemAxon
Refractivity8.72 m3·mol-1ChemAxon
Polarizability2.81 Å3ChemAxon
Number of Rings0ChemAxon
Rule of FiveYesChemAxon
Ghose FilterNoChemAxon
Veber's RuleNoChemAxon
MDDR-like RuleNoChemAxon
Predicted ADMET Features
Not Available


Mass Spec (NIST)
Not Available
SpectrumSpectrum TypeSplash Key
Predicted MS/MS Spectrum - 10V, Positive (Annotated)Predicted LC-MS/MSsplash10-0002-9000000000-701578487c4dc8b94d22
Predicted MS/MS Spectrum - 20V, Positive (Annotated)Predicted LC-MS/MSsplash10-0002-9000000000-701578487c4dc8b94d22
Predicted MS/MS Spectrum - 40V, Positive (Annotated)Predicted LC-MS/MSsplash10-0002-9000000000-701578487c4dc8b94d22
Predicted MS/MS Spectrum - 10V, Negative (Annotated)Predicted LC-MS/MSsplash10-0002-9000000000-9c61b79c18a51c772d86
Predicted MS/MS Spectrum - 20V, Negative (Annotated)Predicted LC-MS/MSsplash10-0002-9000000000-9c61b79c18a51c772d86
Predicted MS/MS Spectrum - 40V, Negative (Annotated)Predicted LC-MS/MSsplash10-0002-9000000000-9c61b79c18a51c772d86


Build, predict & validate machine-learning models
Use our structured and evidence-based datasets to unlock new
insights and accelerate drug research.
Learn more
Use our structured and evidence-based datasets to unlock new insights and accelerate drug research.
Learn more
Pharmacological action
General Function
Oxygen transporter activity
Specific Function
Involved in oxygen transport from the lung to the various peripheral tissues.
Gene Name
Uniprot ID
Uniprot Name
Hemoglobin subunit alpha
Molecular Weight
15257.405 Da
  1. Baskin SI, Horowitz AM, Nealley EW: The antidotal action of sodium nitrite and sodium thiosulfate against cyanide poisoning. J Clin Pharmacol. 1992 Apr;32(4):368-75. [Article]
Pharmacological action
General Function
Oxygen transporter activity
Specific Function
Involved in oxygen transport from the lung to the various peripheral tissues.LVV-hemorphin-7 potentiates the activity of bradykinin, causing a decrease in blood pressure.Spinorphin: functions as an...
Gene Name
Uniprot ID
Uniprot Name
Hemoglobin subunit beta
Molecular Weight
15998.34 Da
  1. Baskin SI, Horowitz AM, Nealley EW: The antidotal action of sodium nitrite and sodium thiosulfate against cyanide poisoning. J Clin Pharmacol. 1992 Apr;32(4):368-75. [Article]
Pharmacological action
General Function
Oxygen transporter activity
Specific Function
Serves as a reserve supply of oxygen and facilitates the movement of oxygen within muscles.
Gene Name
Uniprot ID
Uniprot Name
Molecular Weight
17183.725 Da
  1. Baskin SI, Horowitz AM, Nealley EW: The antidotal action of sodium nitrite and sodium thiosulfate against cyanide poisoning. J Clin Pharmacol. 1992 Apr;32(4):368-75. [Article]

Drug created at September 21, 2015 16:24 / Updated at October 06, 2022 03:22