


Sulfasalazine is an anti-inflammatory drug used to treat Crohn's disease and rheumatoid arthritis.

Brand Names
Azulfidine, Salazopyrin, Salazopyrin En-tabs
Generic Name
DrugBank Accession Number

A drug that is used in the management of inflammatory bowel diseases. Its activity is generally considered to lie in its metabolic breakdown product, 5-aminosalicylic acid (see mesalamine) released in the colon. (From Martindale, The Extra Pharmacopoeia, 30th ed, p907)

Small Molecule
Average: 398.393
Monoisotopic: 398.068490268
Chemical Formula
  • 2-Hydroxy-5-((4-((2-pyridinylamino)sulfonyl)phenyl)azo)benzoic acid
  • 2-Hydroxy-5-[4-(pyridin-2-ylsulfamoyl)-phenylazo]-benzoic acid
  • 4-(Pyridyl-2-amidosulfonyl)-3'-carboxy-4'-hydroxyazobenzene
  • 5-((p-(2-Pyridylsulfamoyl)phenyl)azo)salicylic acid
  • 5-(4-(2-Pyridylsulfamoyl)phenylazo)-2-hydroxybenzoic acid
  • 5-(p-(2-Pyridylsulfamyl)phenylazo)salicylic acid
  • Azopyrin
  • Salazosulfapiridina
  • Salazosulfapyridine
  • Salazosulfapyridinum
  • Salicylazosulfapyridine
  • Sulfasalazin
  • Sulfasalazina
  • Sulfasalazine
  • Sulfasalazinum
External IDs
  • NSC-203730
  • NSC-667219
  • SSZ



For the treatment of Crohn's disease and rheumatoid arthritis as a second-line agent.

Accelerate your drug discovery research with the industry’s only fully connected ADMET dataset, ideal for:
Machine Learning
Data Science
Drug Discovery
Accelerate your drug discovery research with our fully connected ADMET dataset
Learn more
Associated Conditions
Contraindications & Blackbox Warnings
Contraindications & Blackbox Warnings
With our commercial data, access important information on dangerous risks, contraindications, and adverse effects.
Learn more
Our Blackbox Warnings cover Risks, Contraindications, and Adverse Effects
Learn more

Sulfasalazine is an anti-inflammatory indicated for the treatment of ulcerative colitis and rheumatoid arthritis.

Mechanism of action

The mode of action of Sulfasalazine or its metabolites, 5-aminosalicylic acid (5-ASA) and sulfapyridine (SP), is still under investigation, but may be related to the anti-inflammatory and/or immunomodulatory properties that have been observed in animal and in vitro models, to its affinity for connective tissue, and/or to the relatively high concentration it reaches in serous fluids, the liver and intestinal walls, as demonstrated in autoradiographic studies in animals. In ulcerative colitis, clinical studies utilizing rectal administration of Sulfasalazine, SP and 5-ASA have indicated that the major therapeutic action may reside in the 5-ASA moiety. The relative contribution of the parent drug and the major metabolites in rheumatoid arthritis is unknown.

AArachidonate 5-lipoxygenase
AProstaglandin G/H synthase 2
AProstaglandin G/H synthase 1
APeroxisome proliferator-activated receptor gamma
UInhibitor of nuclear factor kappa-B kinase subunit alpha
UInhibitor of nuclear factor kappa-B kinase subunit beta
UCystine/glutamate transporter
UAcetyl-CoA acetyltransferase, mitochondrial
UThromboxane-A synthase
UPhospholipase A2

Not Available

Volume of distribution
  • 7.5 ± 1.6 L
Protein binding

Not Available

Not Available
Route of elimination

The majority of 5-ASA stays within the colonic lumen and is excreted as 5-ASA and acetyl-5-ASA with the feces.


5-10 hours

  • 1 L/h [IV administration]
Adverse Effects
Reduce medical errors
and improve treatment outcomes with our comprehensive & structured data on drug adverse effects.
Learn more
Reduce medical errors & improve treatment outcomes with our adverse effects data
Learn more

Not Available

Not Available
Pharmacogenomic Effects/ADRs
Interacting Gene/EnzymeAllele nameGenotype(s)Defining Change(s)Type(s)DescriptionDetails
Arylamine N-acetyltransferase 1NAT1*14ANot AvailableG > A | T > A | C > AADR InferredIncreased risk of Sulfapyridine dose related adverse effects, including skin rash.Details
Arylamine N-acetyltransferase 1NAT1*14BNot AvailableG > AADR InferredIncreased risk of Sulfapyridine dose related adverse effects, including skin rash.Details
Arylamine N-acetyltransferase 1NAT1*15Not AvailableC > TADR InferredIncreased risk of Sulfapyridine dose related adverse effects, including skin rash.Details
Arylamine N-acetyltransferase 1NAT1*17Not AvailableC > TADR InferredIncreased risk of Sulfapyridine dose related adverse effects, including skin rash.Details
Arylamine N-acetyltransferase 1NAT1*19ANot AvailableC > TADR InferredIncreased risk of Sulfapyridine dose related adverse effects, including skin rash.Details
Arylamine N-acetyltransferase 1NAT1*19BNot AvailableC > T | C > TADR InferredIncreased risk of Sulfapyridine dose related adverse effects, including skin rash.Details
Arylamine N-acetyltransferase 1NAT1*22Not AvailableA > TADR InferredIncreased risk of Sulfapyridine dose related adverse effects, including skin rash.Details
Arylamine N-acetyltransferase 2NAT2*5ANot AvailableT > C | C > TADR InferredIncreased risk of Sulfapyridine dose related adverse effects, including skin rash.Details
Arylamine N-acetyltransferase 2NAT2*5BNot AvailableT > C | C > T | A > GADR InferredIncreased risk of Sulfapyridine dose related adverse effects, including skin rash.Details
Arylamine N-acetyltransferase 2NAT2*5CNot AvailableT > C | A > GADR InferredIncreased risk of Sulfapyridine dose related adverse effects, including skin rash.Details
Arylamine N-acetyltransferase 2NAT2*5DNot AvailableT > CADR InferredIncreased risk of Sulfapyridine dose related adverse effects, including skin rash.Details
Arylamine N-acetyltransferase 2NAT2*5ENot AvailableT > C | G > AADR InferredIncreased risk of Sulfapyridine dose related adverse effects, including skin rash.Details
Arylamine N-acetyltransferase 2NAT2*5FNot AvailableT > C | C > T | C > T | A > GADR InferredIncreased risk of Sulfapyridine dose related adverse effects, including skin rash.Details
Arylamine N-acetyltransferase 2NAT2*5GNot AvailableT > C | C > T | C > T | A > GADR InferredIncreased risk of Sulfapyridine dose related adverse effects, including skin rash.Details
Arylamine N-acetyltransferase 2NAT2*5HNot AvailableT > C | C > T | A > G | S287 FrameshiftADR InferredIncreased risk of Sulfapyridine dose related adverse effects, including skin rash.Details
Arylamine N-acetyltransferase 2NAT2*5INot AvailableT > C | C > T | A > T | A > GADR InferredIncreased risk of Sulfapyridine dose related adverse effects, including skin rash.Details
Arylamine N-acetyltransferase 2NAT2*5JNot AvailableT > C | C > T | G > AADR InferredIncreased risk of Sulfapyridine dose related adverse effects, including skin rash.Details
Arylamine N-acetyltransferase 2NAT2*6ANot AvailableG > A | C > TADR InferredIncreased risk of Sulfapyridine dose related adverse effects, including skin rash.Details
Arylamine N-acetyltransferase 2NAT2*6BNot AvailableG > AADR InferredIncreased risk of Sulfapyridine dose related adverse effects, including skin rash.Details
Arylamine N-acetyltransferase 2NAT2*6CNot AvailableG > A | C > T | A > GADR InferredIncreased risk of Sulfapyridine dose related adverse effects, including skin rash.Details
Arylamine N-acetyltransferase 2NAT2*6DNot AvailableG > A | C > T | T > CADR InferredIncreased risk of Sulfapyridine dose related adverse effects, including skin rash.Details
Arylamine N-acetyltransferase 2NAT2*6ENot AvailableG > A | C > TADR InferredIncreased risk of Sulfapyridine dose related adverse effects, including skin rash.Details
Arylamine N-acetyltransferase 2NAT2*7ANot AvailableG > AADR InferredIncreased risk of Sulfapyridine dose related adverse effects, including skin rash.Details
Arylamine N-acetyltransferase 2NAT2*7BNot AvailableG > A | C > TADR InferredIncreased risk of Sulfapyridine dose related adverse effects, including skin rash.Details
Arylamine N-acetyltransferase 2NAT2*10Not AvailableG > AADR InferredIncreased risk of Sulfapyridine dose related adverse effects, including skin rash.Details
Arylamine N-acetyltransferase 2NAT2*12DNot AvailableG > A | A > GADR InferredIncreased risk of Sulfapyridine dose related adverse effects, including skin rash.Details
Arylamine N-acetyltransferase 2NAT2*14ANot AvailableG > AADR InferredIncreased risk of Sulfapyridine dose related adverse effects, including skin rash.Details
Arylamine N-acetyltransferase 2NAT2*14BNot AvailableG > A | C > TADR InferredIncreased risk of Sulfapyridine dose related adverse effects, including skin rash.Details
Arylamine N-acetyltransferase 2NAT2*14CNot AvailableG > A | T > C | C > T | A > GADR InferredIncreased risk of Sulfapyridine dose related adverse effects, including skin rash.Details
Arylamine N-acetyltransferase 2NAT2*14DNot AvailableG > A | C > T | G > AADR InferredIncreased risk of Sulfapyridine dose related adverse effects, including skin rash.Details
Arylamine N-acetyltransferase 2NAT2*14ENot AvailableG > A | A > GADR InferredIncreased risk of Sulfapyridine dose related adverse effects, including skin rash.Details
Arylamine N-acetyltransferase 2NAT2*14FNot AvailableG > A | T > C | A > GADR InferredIncreased risk of Sulfapyridine dose related adverse effects, including skin rash.Details
Arylamine N-acetyltransferase 2NAT2*14GNot AvailableG > A | C > T | A > GADR InferredIncreased risk of Sulfapyridine dose related adverse effects, including skin rash.Details
Arylamine N-acetyltransferase 2NAT2*17Not AvailableA > CADR InferredIncreased risk of Sulfapyridine dose related adverse effects, including skin rash.Details
Arylamine N-acetyltransferase 2NAT2*19Not AvailableC > TADR InferredIncreased risk of Sulfapyridine dose related adverse effects, including skin rash.Details
Glucose-6-phosphate 1-dehydrogenaseVilleurbanneNot Available1000_1002delACCADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTorunNot Available1006A->GADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSunderlandNot Available105_107delCATADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseIwatsukiNot Available1081G->AADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSerresNot Available1082C->TADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTondelaNot Available1084_1101delCTGAACGAGCGCAAGGCCADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLoma LindaNot Available1089C->AADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAachenNot Available1089C->GADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTenriNot Available1096A->GADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMontpellierNot Available1132G>AADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCalvo MackennaNot Available1138A->GADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseRileyNot Available1139T->CADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseOlomoucNot Available1141T->CADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTomahNot Available1153T->CADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLynwoodNot Available1154G->TADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMadridNot Available1155C->GADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseIowa, Walter Reed, SpringfieldNot Available1156A->GADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBeverly Hills, Genova, Iwate, Niigata, YamaguchiNot Available1160G->AADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHartfordNot Available1162A->GADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePrahaNot Available1166A->GADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKrakowNot Available1175T>CADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseWisconsinNot Available1177C->GADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNashville, Anaheim, PorticiNot Available1178G->AADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAlhambraNot Available1180G->CADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBariNot Available1187C->TADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePuerto LimonNot Available1192G->AADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCovao do LoboNot Available1205C>AADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseClinicNot Available1215G->AADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseUtrechtNot Available1225C->TADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSuwalkiNot Available1226C->GADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseRiversideNot Available1228G->TADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseJapan, ShinagawaNot Available1229G->AADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKawasakiNot Available1229G->CADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMunichNot Available1231A->GADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseGeorgiaNot Available1284C->AADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSumareNot Available1292T->GADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTelti/KobeNot Available1318C->TADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSantiago de Cuba, MoriokaNot Available1339G->AADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHarimaNot Available1358T->AADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseFiguera da FozNot Available1366G->CADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAmiensNot Available1367A>TADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBangkok NoiNot Available1376G->T, 1502T->GADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseFukayaNot Available1462G->AADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCampinasNot Available1463G->TADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBuenos AiresNot Available1465C>TADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseArakawaNot Available1466C->TADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBrightonNot Available1488_1490delGAAADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKozukataNot Available159G->CADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAmsterdamNot Available180_182delTCTADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNo nameNot Available202G->A, 376A->G, 1264C>GADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSwanseaNot Available224T->CADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseUrayasuNot Available281_283delAGAADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseVancouverNot Available317C->G544C->T592C->TADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMt SinaiNot Available376A->G, 1159C->TADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePlymouthNot Available488G->AADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseVolendamNot Available514C->TADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseShinshuNot Available527A->GADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseChikugoNot Available535A->TADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTsukuiNot Available561_563delCTCADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePedoplis-CkaroNot Available573C>GADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSantiagoNot Available593G->CADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMinnesota, Marion, Gastonia, LeJeuneNot Available637G->TADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCincinnatiNot Available637G->T, 1037A->TADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHarilaouNot Available648T->GADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNorth DallasNot Available683_685delACAADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAsahikawaNot Available695G->AADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseDurhamNot Available713A->GADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseStonybrookNot Available724_729delGGCACTADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseWayneNot Available769C->GADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAveiroNot Available806G->AADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCleveland CorumNot Available820G->AADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLilleNot Available821A>TADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBangkokNot Available825G>CADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSugaoNot Available826C->TADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLa JollaNot Available832T->CADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseWexhamNot Available833C->TADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePiotrkowNot Available851T>CADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseWest VirginiaNot Available910G->TADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseOmiyaNot Available921G->CADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNaraNot Available953_976delCCACCAAAGGGTACCTGGAC GACCADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseManhattanNot Available962G->AADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseRehevotNot Available964T->CADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHoniaraNot Available99A->G / 1360C->TADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTokyo, FukushimaNot Available1246G->AADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseChathamNot Available1003G->AADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseFushanNot Available1004C->AADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePartenopeNot Available1052G->TADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseIerapetraNot Available1057C->TADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAnadiaNot Available1193A->GADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAbenoNot Available1220A->CADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSurabayaNot Available1291G->AADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePawneeNot Available1316G->CADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseS. AntiocoNot Available1342A->GADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCassanoNot Available1347G->CADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHermoupolisNot Available1347G->C / 1360C->TADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseUnion,Maewo, Chinese-2, KaloNot Available1360C->TADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAndalusNot Available1361G->AADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCosenzaNot Available1376G->CADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCanton, Taiwan- Hakka, Gifu-like, Agrigento-likeNot Available1376G->TADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseFloresNot Available1387C->AADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKaiping, Anant, Dhon, Sapporo-like, WoseraNot Available1388G->AADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKamogawaNot Available169C->TADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCostanzoNot Available179T>CADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAmazoniaNot Available185C->AADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSongklanagarindNot Available196T->AADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHechiNot Available202G->A / 871G->AADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNamouruNot Available208T->CADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBao LocNot Available352T>CADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCrispimNot Available375G->T, 379G->T383T->C384C>TADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAcrokorinthosNot Available376A->G / 463C->GADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSanta MariaNot Available376A->G / 542A->TADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAnanindeuaNot Available376A->G / 871G->AADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseVanua LavaNot Available383T->CADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseValladolidNot Available406C->TADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBelemNot Available409C->TADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLiuzhouNot Available442G->AADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseShenzenNot Available473G>AADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTaipei “Chinese- 3”Not Available493A->GADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseToledoNot Available496C>TADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNaoneNot Available497G->AADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNankangNot Available517T->CADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMiaoliNot Available519C->GADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMediterranean, Dallas, Panama‚ Sassari, Cagliari, BirminghamNot Available563C->TADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCoimbra ShundeNot Available592C->TADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNilgiriNot Available593G>AADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseRadlowoNot Available679C->TADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseRoubaixNot Available811G>CADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHaikouNot Available835A->GADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseChinese-1Not Available835A->TADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMizushimaNot Available848A>GADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseOsakaNot Available853C->TADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseViangchan, JammuNot Available871G->AADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSeoulNot Available916G->AADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLudhianaNot Available929G->AADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseFarroupilhaNot Available977C->AADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseChinese-5Not Available1024C->TADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseRignanoNot Available130G>AADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseOrissaNot Available131C->GADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseG6PDNiceNot Available1380G>CADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKamiube, KeelungNot Available1387C->TADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNeapolisNot Available1400C->GADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAuresNot Available143T->CADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSplitNot Available1442C->GADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKambosNot Available148C->TADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePalestrinaNot Available170G>AADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMetapontoNot Available172G->AADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMusashinoNot Available185C->TADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAsahiNot Available202G->AADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseA- (202), Ferrara INot Available202G->A / 376A->GADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMurcia OristanoNot Available209A->GADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseUbe KonanNot Available241C->TADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLagosantoNot Available242G->AADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseGuangzhouNot Available274C->TADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHammersmithNot Available323T->AADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSinnaiNot Available34G->TADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseA- (680)Not Available376A->G / 680G->TADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseA- (968), Betica,Selma, GuantanamoNot Available376A->G / 968T->CADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSalerno PyrgosNot Available383T>GADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseQuing YanNot Available392G->TADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLagesNot Available40G->AADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseIleshaNot Available466G->AADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMahidolNot Available487G->AADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMalagaNot Available542A->TADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSibariNot Available634A->GADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMexico CityNot Available680G->AADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNanningNot Available703C->TADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSeattle, Lodi, Modena, Ferrara II, Athens-likeNot Available844G->CADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBajo MaumereNot Available844G->TADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMontalbanoNot Available854G->AADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKalyan-Kerala, Jamnaga, RohiniNot Available949G->AADR InferredIncreased risk of dose-related hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseGaoheNot Available95A->GADR InferredIncreased risk of dose-related hemolytic anemia.Details


Drug Interactions
This information should not be interpreted without the help of a healthcare provider. If you believe you are experiencing an interaction, contact a healthcare provider immediately. The absence of an interaction does not necessarily mean no interactions exist.
AbacavirSulfasalazine may decrease the excretion rate of Abacavir which could result in a higher serum level.
AbataceptThe risk or severity of adverse effects can be increased when Sulfasalazine is combined with Abatacept.
AbciximabThe risk or severity of bleeding and hemorrhage can be increased when Sulfasalazine is combined with Abciximab.
AbemaciclibSulfasalazine may decrease the excretion rate of Abemaciclib which could result in a higher serum level.
AcarboseSulfasalazine may increase the hypoglycemic activities of Acarbose.
AcebutololSulfasalazine may decrease the antihypertensive activities of Acebutolol.
AceclofenacThe therapeutic efficacy of Sulfasalazine can be decreased when used in combination with Aceclofenac.
AcemetacinThe risk or severity of adverse effects can be increased when Sulfasalazine is combined with Acemetacin.
AcenocoumarolThe risk or severity of bleeding and hemorrhage can be increased when Sulfasalazine is combined with Acenocoumarol.
AcetaminophenThe risk or severity of adverse effects can be increased when Acetaminophen is combined with Sulfasalazine.
Improve patient outcomes
Build effective decision support tools with the industry’s most comprehensive drug-drug interaction checker.
Learn more
Food Interactions
  • Drink plenty of fluids. Inadequate fluid intake is associated with crystalluria and stone formation.
  • Take with food.


Comprehensive & structured drug product info
From application numbers to product codes, connect different identifiers through our commercial datasets.
Learn more
Easily connect various identifiers back to our datasets
Learn more
Product Images
International/Other Brands
Asasurfan (Choseido Pharmaceutical) / Azulfdidina (Pfizer) / Azulfin (Apsen) / Bomecon (Fu Seng) / Colo-Pleon (Sanofi-Aventis) / Disalazin (AC Farma) / Eminapyrin (Taiyo Pharmaceutical) / Flogostop (Ivax) / Iwata (Cadila) / Lanofen (Taisho Yakuhin) / Lazafin (Novell) / Pleon (Sanofi-Aventis) / Pyralin EN (Pfizer) / Reumazin (Aristopharma) / Saaz (Ipca) / Saaz-DS (Ipca) / Salasopyrine (Upjohn) / Salazar (Cadila) / Salazidin (Helcor) / Salazine (Opsonin) / Salazopirina (Jaba Recordati) / Salazoprin (Cazi) / Salazopyrin (Pfizer) / Salazopyrin EN (Pfizer) / Salazopyrin EN-Tabs (Pharmacia) / Sulcolon (Bernofarm) / Sulfacol (Drug International) / Weiliufen (Sunve) / Zopyrin (Han Lim)
Brand Name Prescription Products
NameDosageStrengthRouteLabellerMarketing StartMarketing EndRegionImage
AzulfidineTablet500 mg/1OralPhysicians Total Care, Inc.1995-11-062011-06-30US flag
AzulfidineTablet500 mg/1OralPfizer Laboratories Div Pfizer Inc1950-06-20Not applicableUS flag
Azulfidine EN-tabsTablet, delayed release500 mg/1OralPfizer Laboratories Div Pfizer Inc1950-06-20Not applicableUS flag
S.A.S. Enteric 500mgTablet, delayed release500 mgOralIcn Pharmaceuticals1979-12-312005-04-26Canada flag
Salazopyrin En-tabs 500 mgTablet, delayed release500 mgOralPfizer Canada Ulc1995-12-31Not applicableCanada flag
Salazopyrin Enema 3.0gm/100mlSuspension3 g / 100 mLRectalKabi Pharmacia Canada Inc.1994-12-311996-09-10Canada flag
Salazopyrin Enema 3gm/100mlEnema3 g / 100 mLRectalPfizer Canada Ulc1996-12-312006-08-02Canada flag
Salazopyrin Tab 500mgTablet500 mgOralPfizer Canada Ulc1995-12-31Not applicableCanada flag
Sas Enema 3gm/100mlEnema3 g / 100 mLRectalIcn Pharmaceuticals1984-12-312005-04-26Canada flag
Sas Tab 500mgTablet500 mgOralIcn Pharmaceuticals1973-12-312005-04-26Canada flag
Generic Prescription Products
NameDosageStrengthRouteLabellerMarketing StartMarketing EndRegionImage
Apo Sulfasalazine Tab 500mgTablet500 mgOralApotex Corporation1978-12-31Not applicableCanada flag
Orb-sulfasalazine ECTablet, delayed release500 mgOralOrbus Pharma IncNot applicableNot applicableCanada flag
PMS-sulfasalazine 500mg/tab USPTablet500 mgOralPharmascience Inc1984-12-31Not applicableCanada flag
PMS-sulfasalazine-E.C. Tab 500mgTablet, delayed release500 mgOralPharmascience Inc1984-12-31Not applicableCanada flag
Ratio-sulfasalazine EnTablet, delayed release500 mgOralRatiopharm Inc Division Of Teva Canada Limited1986-12-312008-08-01Canada flag
Ratio-sulfasalazine Tab 500mgTablet500 mgOralRatiopharm Inc Division Of Teva Canada Limited1986-12-312008-08-01Canada flag
SulfasalazineTablet500 mg/1OralGreenstone LLC2003-07-01Not applicableUS flag
SulfasalazineTablet500 mg/1OralAphena Pharma Solutions - Tennessee, LLC2003-07-01Not applicableUS flag
SulfasalazineTablet500 mg/1OralRemedy Repack2011-11-182016-02-04US flag
SulfasalazineTablet500 mg/1OralAidarex Pharmaceuticals LLC2002-01-11Not applicableUS flag33261 075620210513 12105 1n9zsm2


ATC Codes
G01AE10 — Combinations of sulfonamidesA07EC01 — Sulfasalazine
Drug Categories
Chemical TaxonomyProvided by Classyfire
This compound belongs to the class of organic compounds known as azobenzenes. These are organonitrogen aromatic compounds that contain a central azo group, where each nitrogen atom is conjugated to a benzene ring.
Organic compounds
Super Class
Organoheterocyclic compounds
Sub Class
Not Available
Direct Parent
Alternative Parents
Salicylic acids / Benzenesulfonamides / Benzenesulfonyl compounds / Benzoic acids / Benzoyl derivatives / 1-hydroxy-2-unsubstituted benzenoids / Pyridines and derivatives / Organosulfonamides / Imidolactams / Vinylogous acids
show 11 more
1-hydroxy-2-unsubstituted benzenoid / Aminosulfonyl compound / Aromatic heteromonocyclic compound / Azacycle / Azo compound / Azobenzene / Benzenesulfonamide / Benzenesulfonyl group / Benzenoid / Benzoic acid
show 28 more
Molecular Framework
Aromatic heteromonocyclic compounds
External Descriptors
sulfonamide, azobenzenes, pyridines (CHEBI:9334)
Affected organisms
  • Humans and other mammals

Chemical Identifiers

CAS number
InChI Key
2-hydroxy-5-[(E)-2-{4-[(pyridin-2-yl)sulfamoyl]phenyl}diazen-1-yl]benzoic acid


General References
Not Available
Human Metabolome Database
KEGG Compound
PubChem Compound
PubChem Substance
Therapeutic Targets Database
PDBe Ligand
RxList Drug Page Drug Page
PDB Entries
13gs / 4j7x / 5acl / 6g0g / 6r7s
FDA label
Download (796 KB)
Download (72.8 KB)

Clinical Trials

Clinical Trials
4Active Not RecruitingTreatmentRheumatoid Arthritis1
4CompletedBasic ScienceRheumatoid Arthritis1
4CompletedTreatmentAnkylosing Spondylitis (AS)1
4CompletedTreatmentPsoriatic Arthritis1
4CompletedTreatmentRheumatoid Arthritis6
4Not Yet RecruitingTreatmentAnkylosing Spondylitis (AS) / Spondyloarthritis1
4Not Yet RecruitingTreatmentRheumatoid Arthritis1
4RecruitingTreatmentCardiovascular Risk / Endothelial Dysfunction / Rheumatoid Arthritis / Stiffness, Aortic1
4RecruitingTreatmentPsoriatic Arthritis1
4TerminatedTreatmentRheumatoid Arthritis1


  • Pharmacia and upjohn co
  • Vintage pharmaceuticals inc
  • Watson laboratories inc
  • Solvay pharmaceuticals
  • Heritage pharmaceuticals inc
  • Mutual pharmaceutical co inc
  • Sandoz inc
  • Superpharm corp
  • Amerisource Health Services Corp.
  • A-S Medication Solutions LLC
  • Carlisle Laboratories Inc.
  • Darby Dental Supply Co. Inc.
  • Direct Dispensing Inc.
  • Dispensing Solutions
  • Greenstone LLC
  • Kaiser Foundation Hospital
  • Kemwell AB
  • Major Pharmaceuticals
  • Medisca Inc.
  • Murfreesboro Pharmaceutical Nursing Supply
  • Mutual Pharmaceutical Co.
  • Nucare Pharmaceuticals Inc.
  • Patheon Inc.
  • PD-Rx Pharmaceuticals Inc.
  • Pfizer Inc.
  • Pharmacia Inc.
  • Pharmedix
  • Physicians Total Care Inc.
  • Prepak Systems Inc.
  • Qualitest
  • Remedy Repack
  • Tya Pharmaceuticals
  • United Research Laboratories Inc.
  • Vintage Pharmaceuticals Inc.
  • Watson Pharmaceuticals
Dosage Forms
Tablet, film coatedOral
Tablet, delayed releaseOral500 mg
SuspensionRectal3 g / 100 mL
EnemaRectal3 g / 100 mL
TabletOral500 MG
Tablet, delayed releaseOral
Tablet, coatedOral500 mg
Tablet, film coatedOral500 mg
PowderNot applicable1 g/1g
TabletOral500 mg/1
Tablet, film coatedOral500 mg/1
Tablet, delayed releaseOral500 mg/1
Unit descriptionCostUnit
Sulfasalazine powder2.14USD g
Azulfidine EN-tabs 500 mg Enteric Coated Tabs0.73USD tab
Azulfidine entab 500 mg0.69USD tablet
Azulfidine 500 mg tablet0.59USD tablet
Salazopyrin En-Tabs 500 mg Enteric-Coated Tablet0.45USD tablet
Sulfasalazine 500 mg Enteric Coated Tabs0.4USD tab
Pms-Sulfasalazine 500 mg Enteric-Coated Tablet0.34USD tablet
Salazopyrin 500 mg Tablet0.28USD tablet
Sulfasalazine 500 mg tablet0.25USD tablet
Sulfazine 500 mg tablet0.25USD tablet
Pms-Sulfasalazine 500 mg Tablet0.22USD tablet
DrugBank does not sell nor buy drugs. Pricing information is supplied for informational purposes only.
Not Available


Experimental Properties
melting point (°C)220 dec °CPhysProp
logP2.5Not Available
Caco2 permeability-6.33ADME Research, USCD
Predicted Properties
Water Solubility0.0464 mg/mLALOGPS
pKa (Strongest Acidic)3.23ChemAxon
pKa (Strongest Basic)0.55ChemAxon
Physiological Charge-2ChemAxon
Hydrogen Acceptor Count8ChemAxon
Hydrogen Donor Count3ChemAxon
Polar Surface Area141.31 Å2ChemAxon
Rotatable Bond Count5ChemAxon
Refractivity104.6 m3·mol-1ChemAxon
Polarizability39.69 Å3ChemAxon
Number of Rings3ChemAxon
Rule of FiveYesChemAxon
Ghose FilterYesChemAxon
Veber's RuleNoChemAxon
MDDR-like RuleNoChemAxon
Predicted ADMET Features
Human Intestinal Absorption+0.9156
Blood Brain Barrier-0.7294
Caco-2 permeable-0.6893
P-glycoprotein substrateNon-substrate0.8405
P-glycoprotein inhibitor INon-inhibitor0.9096
P-glycoprotein inhibitor IINon-inhibitor0.853
Renal organic cation transporterNon-inhibitor0.8956
CYP450 2C9 substrateNon-substrate0.6445
CYP450 2D6 substrateNon-substrate0.9116
CYP450 3A4 substrateNon-substrate0.7557
CYP450 1A2 substrateNon-inhibitor0.9046
CYP450 2C9 inhibitorInhibitor0.8948
CYP450 2D6 inhibitorNon-inhibitor0.9231
CYP450 2C19 inhibitorNon-inhibitor0.923
CYP450 3A4 inhibitorNon-inhibitor0.8309
CYP450 inhibitory promiscuityLow CYP Inhibitory Promiscuity0.8895
Ames testNon AMES toxic0.9133
BiodegradationNot ready biodegradable0.9472
Rat acute toxicity1.4383 LD50, mol/kg Not applicable
hERG inhibition (predictor I)Weak inhibitor0.939
hERG inhibition (predictor II)Non-inhibitor0.821
ADMET data is predicted using admetSAR, a free tool for evaluating chemical ADMET properties. (23092397)


Mass Spec (NIST)
Not Available
SpectrumSpectrum TypeSplash Key
Predicted GC-MS Spectrum - GC-MSPredicted GC-MSNot Available
Predicted MS/MS Spectrum - 10V, Positive (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 20V, Positive (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 40V, Positive (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 10V, Negative (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 20V, Negative (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 40V, Negative (Annotated)Predicted LC-MS/MSNot Available
MS/MS Spectrum - , positiveLC-MS/MSsplash10-0002-0239100000-5bf223e6e250eb77105a


Accelerate your drug discovery research
with our fully connected ADMET & drug target dataset.
Learn more
Accelerate your drug discovery research with our ADMET & drug target dataset
Learn more
Pharmacological action
General Function
Iron ion binding
Specific Function
Catalyzes the first step in leukotriene biosynthesis, and thereby plays a role in inflammatory processes.
Gene Name
Uniprot ID
Uniprot Name
Arachidonate 5-lipoxygenase
Molecular Weight
77982.595 Da
  1. Nielsen OH, Bukhave K, Elmgreen J, Ahnfelt-Ronne I: Inhibition of 5-lipoxygenase pathway of arachidonic acid metabolism in human neutrophils by sulfasalazine and 5-aminosalicylic acid. Dig Dis Sci. 1987 Jun;32(6):577-82. [Article]
  2. Allgayer H, Eisenburg J, Paumgartner G: Soybean lipoxygenase inhibition: studies with the sulphasalazine metabolites N-acetylaminosalicylic acid, 5-aminosalicylic acid and sulphapyridine. Eur J Clin Pharmacol. 1984;26(4):449-51. [Article]
  3. Sircar JC, Schwender CF, Carethers ME: Inhibition of soybean lipoxygenase by sulfasalazine and 5-aminosalicylic acid: a possible mode of action in ulcerative colitis. Biochem Pharmacol. 1983 Jan 1;32(1):170-2. [Article]
Pharmacological action
General Function
Prostaglandin-endoperoxide synthase activity
Specific Function
Converts arachidonate to prostaglandin H2 (PGH2), a committed step in prostanoid synthesis. Constitutively expressed in some tissues in physiological conditions, such as the endothelium, kidney and...
Gene Name
Uniprot ID
Uniprot Name
Prostaglandin G/H synthase 2
Molecular Weight
68995.625 Da
  1. Mifflin RC, Saada JI, Di Mari JF, Valentich JD, Adegboyega PA, Powell DW: Aspirin-mediated COX-2 transcript stabilization via sustained p38 activation in human intestinal myofibroblasts. Mol Pharmacol. 2004 Feb;65(2):470-8. [Article]
  2. Generini S, Fiori G, Matucci Cerinic M: Therapy of spondylarthropathy in inflammatory bowel disease. Clin Exp Rheumatol. 2002 Nov-Dec;20(6 Suppl 28):S88-94. [Article]
  3. Distrutti E, Sediari L, Mencarelli A, Renga B, Orlandi S, Russo G, Caliendo G, Santagada V, Cirino G, Wallace JL, Fiorucci S: 5-Amino-2-hydroxybenzoic acid 4-(5-thioxo-5H-[1,2]dithiol-3yl)-phenyl ester (ATB-429), a hydrogen sulfide-releasing derivative of mesalamine, exerts antinociceptive effects in a model of postinflammatory hypersensitivity. J Pharmacol Exp Ther. 2006 Oct;319(1):447-58. Epub 2006 Jul 19. [Article]
  4. Cipolla G, Crema F, Sacco S, Moro E, de Ponti F, Frigo G: Nonsteroidal anti-inflammatory drugs and inflammatory bowel disease: current perspectives. Pharmacol Res. 2002 Jul;46(1):1-6. [Article]
  5. Pruzanski W, Stefanski E, Vadas P, Ramamurthy NS: Inhibition of extracellular release of proinflammatory secretory phospholipase A2 (sPLA2) by sulfasalazine: a novel mechanism of anti-inflammatory activity. Biochem Pharmacol. 1997 Jun 15;53(12):1901-7. [Article]
Pharmacological action
General Function
Prostaglandin-endoperoxide synthase activity
Specific Function
Converts arachidonate to prostaglandin H2 (PGH2), a committed step in prostanoid synthesis. Involved in the constitutive production of prostanoids in particular in the stomach and platelets. In gas...
Gene Name
Uniprot ID
Uniprot Name
Prostaglandin G/H synthase 1
Molecular Weight
68685.82 Da
  1. Allgayer H: Review article: mechanisms of action of mesalazine in preventing colorectal carcinoma in inflammatory bowel disease. Aliment Pharmacol Ther. 2003 Sep;18 Suppl 2:10-4. [Article]
Pharmacological action
General Function
Zinc ion binding
Specific Function
Nuclear receptor that binds peroxisome proliferators such as hypolipidemic drugs and fatty acids. Once activated by a ligand, the nuclear receptor binds to DNA specific PPAR response elements (PPRE...
Gene Name
Uniprot ID
Uniprot Name
Peroxisome proliferator-activated receptor gamma
Molecular Weight
57619.58 Da
  1. Rousseaux C, Lefebvre B, Dubuquoy L, Lefebvre P, Romano O, Auwerx J, Metzger D, Wahli W, Desvergne B, Naccari GC, Chavatte P, Farce A, Bulois P, Cortot A, Colombel JF, Desreumaux P: Intestinal antiinflammatory effect of 5-aminosalicylic acid is dependent on peroxisome proliferator-activated receptor-gamma. J Exp Med. 2005 Apr 18;201(8):1205-15. Epub 2005 Apr 11. [Article]
  2. Schwab M, Reynders V, Loitsch S, Shastri YM, Steinhilber D, Schroder O, Stein J: PPARgamma is involved in mesalazine-mediated induction of apoptosis and inhibition of cell growth in colon cancer cells. Carcinogenesis. 2008 Jul;29(7):1407-14. doi: 10.1093/carcin/bgn118. Epub 2008 Jun 9. [Article]
  3. Linard C, Gremy O, Benderitter M: Reduction of peroxisome proliferation-activated receptor gamma expression by gamma-irradiation as a mechanism contributing to inflammatory response in rat colon: modulation by the 5-aminosalicylic acid agonist. J Pharmacol Exp Ther. 2008 Mar;324(3):911-20. Epub 2007 Dec 12. [Article]
  4. Desreumaux P, Ghosh S: Review article: mode of action and delivery of 5-aminosalicylic acid - new evidence. Aliment Pharmacol Ther. 2006 Sep;24 Suppl 1:2-9. [Article]
Pharmacological action
General Function
Scaffold protein binding
Specific Function
Serine kinase that plays an essential role in the NF-kappa-B signaling pathway which is activated by multiple stimuli such as inflammatory cytokines, bacterial or viral products, DNA damages or oth...
Gene Name
Uniprot ID
Uniprot Name
Inhibitor of nuclear factor kappa-B kinase subunit alpha
Molecular Weight
84638.88 Da
  1. Weber CK, Liptay S, Wirth T, Adler G, Schmid RM: Suppression of NF-kappaB activity by sulfasalazine is mediated by direct inhibition of IkappaB kinases alpha and beta. Gastroenterology. 2000 Nov;119(5):1209-18. [Article]
  2. Allgayer H: Review article: mechanisms of action of mesalazine in preventing colorectal carcinoma in inflammatory bowel disease. Aliment Pharmacol Ther. 2003 Sep;18 Suppl 2:10-4. [Article]
Pharmacological action
General Function
Scaffold protein binding
Specific Function
Serine kinase that plays an essential role in the NF-kappa-B signaling pathway which is activated by multiple stimuli such as inflammatory cytokines, bacterial or viral products, DNA damages or oth...
Gene Name
Uniprot ID
Uniprot Name
Inhibitor of nuclear factor kappa-B kinase subunit beta
Molecular Weight
86563.245 Da
  1. Weber CK, Liptay S, Wirth T, Adler G, Schmid RM: Suppression of NF-kappaB activity by sulfasalazine is mediated by direct inhibition of IkappaB kinases alpha and beta. Gastroenterology. 2000 Nov;119(5):1209-18. [Article]
  2. Allgayer H: Review article: mechanisms of action of mesalazine in preventing colorectal carcinoma in inflammatory bowel disease. Aliment Pharmacol Ther. 2003 Sep;18 Suppl 2:10-4. [Article]
Pharmacological action
General Function
Cystine:glutamate antiporter activity
Specific Function
Sodium-independent, high-affinity exchange of anionic amino acids with high specificity for anionic form of cystine and glutamate.
Gene Name
Uniprot ID
Uniprot Name
Cystine/glutamate transporter
Molecular Weight
55422.44 Da
  1. Chen X, Ji ZL, Chen YZ: TTD: Therapeutic Target Database. Nucleic Acids Res. 2002 Jan 1;30(1):412-5. [Article]
  2. Gout PW, Buckley AR, Simms CR, Bruchovsky N: Sulfasalazine, a potent suppressor of lymphoma growth by inhibition of the x(c)- cystine transporter: a new action for an old drug. Leukemia. 2001 Oct;15(10):1633-40. [Article]
Pharmacological action
General Function
Metal ion binding
Specific Function
Plays a major role in ketone body metabolism.
Gene Name
Uniprot ID
Uniprot Name
Acetyl-CoA acetyltransferase, mitochondrial
Molecular Weight
45199.2 Da
  1. Overington JP, Al-Lazikani B, Hopkins AL: How many drug targets are there? Nat Rev Drug Discov. 2006 Dec;5(12):993-6. [Article]
  2. Imming P, Sinning C, Meyer A: Drugs, their targets and the nature and number of drug targets. Nat Rev Drug Discov. 2006 Oct;5(10):821-34. [Article]
  3. Faison LD, White HL: Sulfasalazine inhibits lyso-PAF: acetyl-COA acetyltransferase. Prostaglandins. 1992 Sep;44(3):245-9. [Article]
Pharmacological action
General Function
Thromboxane-a synthase activity
Specific Function
Not Available
Gene Name
Uniprot ID
Uniprot Name
Thromboxane-A synthase
Molecular Weight
60517.69 Da
  1. Stenson WF, Lobos E: Inhibition of platelet thromboxane synthetase by sulfasalazine. Biochem Pharmacol. 1983 Jul 15;32(14):2205-9. [Article]
Pharmacological action
General Function
Receptor binding
Specific Function
PA2 catalyzes the calcium-dependent hydrolysis of the 2-acyl groups in 3-sn-phosphoglycerides, this releases glycerophospholipids and arachidonic acid that serve as the precursors of signal molecules.
Gene Name
Uniprot ID
Uniprot Name
Phospholipase A2
Molecular Weight
16359.535 Da
  1. Pruzanski W, Stefanski E, Vadas P, Ramamurthy NS: Inhibition of extracellular release of proinflammatory secretory phospholipase A2 (sPLA2) by sulfasalazine: a novel mechanism of anti-inflammatory activity. Biochem Pharmacol. 1997 Jun 15;53(12):1901-7. [Article]


Pharmacological action
General Function
Xenobiotic-transporting atpase activity
Specific Function
High-capacity urate exporter functioning in both renal and extrarenal urate excretion. Plays a role in porphyrin homeostasis as it is able to mediates the export of protoporhyrin IX (PPIX) both fro...
Gene Name
Uniprot ID
Uniprot Name
ATP-binding cassette sub-family G member 2
Molecular Weight
72313.47 Da
  1. Karlsson JE, Heddle C, Rozkov A, Rotticci-Mulder J, Tuvesson O, Hilgendorf C, Andersson TB: High-activity p-glycoprotein, multidrug resistance protein 2, and breast cancer resistance protein membrane vesicles prepared from transiently transfected human embryonic kidney 293-epstein-barr virus nuclear antigen cells. Drug Metab Dispos. 2010 Apr;38(4):705-14. doi: 10.1124/dmd.109.028886. Epub 2010 Jan 13. [Article]
  2. Shukla S, Zaher H, Hartz A, Bauer B, Ware JA, Ambudkar SV: Curcumin inhibits the activity of ABCG2/BCRP1, a multidrug resistance-linked ABC drug transporter in mice. Pharm Res. 2009 Feb;26(2):480-7. doi: 10.1007/s11095-008-9735-8. Epub 2008 Oct 9. [Article]
  3. Dahan A, Amidon GL: Small intestinal efflux mediated by MRP2 and BCRP shifts sulfasalazine intestinal permeability from high to low, enabling its colonic targeting. Am J Physiol Gastrointest Liver Physiol. 2009 Aug;297(2):G371-7. doi: 10.1152/ajpgi.00102.2009. Epub 2009 Jun 18. [Article]
Pharmacological action
General Function
Organic anion transmembrane transporter activity
Specific Function
Mediates hepatobiliary excretion of numerous organic anions. May function as a cellular cisplatin transporter.
Gene Name
Uniprot ID
Uniprot Name
Canalicular multispecific organic anion transporter 1
Molecular Weight
174205.64 Da
  1. Dahan A, Amidon GL: Small intestinal efflux mediated by MRP2 and BCRP shifts sulfasalazine intestinal permeability from high to low, enabling its colonic targeting. Am J Physiol Gastrointest Liver Physiol. 2009 Aug;297(2):G371-7. doi: 10.1152/ajpgi.00102.2009. Epub 2009 Jun 18. [Article]
Pharmacological action
General Function
Methotrexate transporter activity
Specific Function
Has been shown to act both as an intestinal proton-coupled high-affinity folate transporter and as an intestinal heme transporter which mediates heme uptake from the gut lumen into duodenal epithel...
Gene Name
Uniprot ID
Uniprot Name
Proton-coupled folate transporter
Molecular Weight
49770.04 Da
  1. Nakai Y, Inoue K, Abe N, Hatakeyama M, Ohta KY, Otagiri M, Hayashi Y, Yuasa H: Functional characterization of human proton-coupled folate transporter/heme carrier protein 1 heterologously expressed in mammalian cells as a folate transporter. J Pharmacol Exp Ther. 2007 Aug;322(2):469-76. Epub 2007 May 2. [Article]
Pharmacological action
General Function
Sodium-independent organic anion transmembrane transporter activity
Specific Function
Mediates the Na(+)-independent uptake of organic anions such as pravastatin, taurocholate, methotrexate, dehydroepiandrosterone sulfate, 17-beta-glucuronosyl estradiol, estrone sulfate, prostagland...
Gene Name
Uniprot ID
Uniprot Name
Solute carrier organic anion transporter family member 1B1
Molecular Weight
76447.99 Da
  1. Karlgren M, Vildhede A, Norinder U, Wisniewski JR, Kimoto E, Lai Y, Haglund U, Artursson P: Classification of inhibitors of hepatic organic anion transporting polypeptides (OATPs): influence of protein expression on drug-drug interactions. J Med Chem. 2012 May 24;55(10):4740-63. doi: 10.1021/jm300212s. Epub 2012 May 15. [Article]
Pharmacological action
General Function
Sodium-independent organic anion transmembrane transporter activity
Specific Function
Mediates the Na(+)-independent uptake of organic anions such as 17-beta-glucuronosyl estradiol, taurocholate, triiodothyronine (T3), leukotriene C4, dehydroepiandrosterone sulfate (DHEAS), methotre...
Gene Name
Uniprot ID
Uniprot Name
Solute carrier organic anion transporter family member 1B3
Molecular Weight
77402.175 Da
  1. Karlgren M, Vildhede A, Norinder U, Wisniewski JR, Kimoto E, Lai Y, Haglund U, Artursson P: Classification of inhibitors of hepatic organic anion transporting polypeptides (OATPs): influence of protein expression on drug-drug interactions. J Med Chem. 2012 May 24;55(10):4740-63. doi: 10.1021/jm300212s. Epub 2012 May 15. [Article]
Pharmacological action
General Function
Sodium-independent organic anion transmembrane transporter activity
Specific Function
Mediates the Na(+)-independent transport of organic anions such as taurocholate, the prostaglandins PGD2, PGE1, PGE2, leukotriene C4, thromboxane B2 and iloprost.
Gene Name
Uniprot ID
Uniprot Name
Solute carrier organic anion transporter family member 2B1
Molecular Weight
76709.98 Da
  1. Karlgren M, Vildhede A, Norinder U, Wisniewski JR, Kimoto E, Lai Y, Haglund U, Artursson P: Classification of inhibitors of hepatic organic anion transporting polypeptides (OATPs): influence of protein expression on drug-drug interactions. J Med Chem. 2012 May 24;55(10):4740-63. doi: 10.1021/jm300212s. Epub 2012 May 15. [Article]

Drug created on June 13, 2005 13:24 / Updated on July 24, 2021 14:57