


Trimethoprim is an antifolate antibiotic often used in combination with sulfamethoxazole to treat a number of infections, including those of the urinary tract, respiratory tract, and gastrointestinal tract.

Brand Names
Bactrim, Polytrim, Primsol, Septra, Sulfatrim
Generic Name
DrugBank Accession Number

Trimethoprim is an antifolate antibacterial agent that inhibits bacterial dihydrofolate reductase (DHFR), a critical enzyme that catalyzes the formation of tetrahydrofolic acid (THF) - in doing so, it prevents the synthesis of bacterial DNA and ultimately continued bacterial survival.14 Trimethoprim is often used in combination with sulfamethoxazole due to their complementary and synergistic mechanisms but may be used as a monotherapy in the treatment and/or prophylaxis of urinary tract infections.14,16 It is structurally and chemically related to pyrimethamine, another antifolate antimicrobial used in the treatment of plasmodial infections.11

Small Molecule
Approved, Vet approved
Average: 290.3177
Monoisotopic: 290.137890462
Chemical Formula
  • 2,4-diamino-5-(3,4,5-trimethoxybenzyl)pyrimidine
  • 5-[(3,4,5-trimethoxyphenyl)methyl]-2,4-pyrimidinediamine
  • Trimethoprim
  • Triméthoprime
  • Trimethoprimum
  • Trimetoprima
External IDs
  • BW 56-72
  • BW-56-72
  • NIH-204
  • NSC-106568
  • Ro 6-2153-12 F



As a monotherapy, trimethoprim is indicated for the treatment of acute episodes of uncomplicated urinary tract infections caused by susceptible bacteria, including E. coli., K. pneumoniae, Enterobacter spp., P. mirabilis, and coagulase-negative Staphylococcus species.14,13 In various formulations in combination with sulfamethoxazole, trimethoprim is indicated for the following infections caused by bacteria with documented susceptibility: urinary tract infections, acute otitis media in pediatric patients (when clinically indicated), acute exacerbations of chronic bronchitis in adults, enteritis caused by susceptible Shigella, prophylaxis and treatment of Pneumocystis jiroveci pneumonia, and travelers' diarrhea caused by enterotoxigenic E. coli.16,19

Trimethoprim is available as an ophthalmic solution in combination with polymyxin B for the treatment of acute bacterial conjunctivitis, blepharitis, and blepharoconjunctivitis caused by susceptible bacteria.12

Accelerate your drug discovery research with the industry’s only fully connected ADMET dataset, ideal for:
Machine Learning
Data Science
Drug Discovery
Accelerate your drug discovery research with our fully connected ADMET dataset
Learn more
Associated Conditions
Contraindications & Blackbox Warnings
Contraindications & Blackbox Warnings
With our commercial data, access important information on dangerous risks, contraindications, and adverse effects.
Learn more
Our Blackbox Warnings cover Risks, Contraindications, and Adverse Effects
Learn more

Trimethoprim exerts its antimicrobial effects by inhibiting an essential step in the synthesis of bacterial nucleic acids and proteins.14 It has shown activity against several species of gram-negative bacteria, as well as coagulase-negative Staphylococcus species. 14 Resistance to trimethoprim may arise via a variety of mechanisms, including alterations to the bacterial cell wall, overproduction of dihydrofolate reductase, or production of resistant dihydrofolate reductase.14 Rarely, trimethoprim can precipitate the development of blood disorders (e.g. thrombocytopenia, leukopenia, etc.) which may be preceded by symptoms such as sore throat, fever, pallor, and or purpura - patients should be monitored closely for the development of these symptoms throught the course of therapy.14

As antimicrobial susceptibility patterns are geographically distinct, local antibiograms should be consulted to ensure adequate coverage of relevant pathogens prior to use.

Mechanism of action

Trimethoprim is a reversible inhibitor of dihydrofolate reductase, one of the principal enzymes catalyzing the formation of tetrahydrofolic acid (THF) from dihydrofolic acid (DHF).14 Tetrahydrofolic acid is necessary for the biosynthesis of bacterial nucleic acids and proteins and ultimately for continued bacterial survival - inhibiting its synthesis, then, results in bactericidal activity. Trimethoprim binds with a much stronger affinity to bacterial dihydrofolate reductase as compared to its mammalian counterpart, allowing trimethoprim to selectively interfere with bacterial biosynthetic processes.14

Trimethoprim is often given in combination with sulfamethoxazole, which inhibits the preceding step in bacterial protein synthesis - given together, sulfamethoxazole and trimethoprim inhibit two consecutive steps in the biosynthesis of bacterial nucleic acids and proteins.16 As a monotherapy trimethoprim is considered bacteriostatic, but in combination with sulfamethoxazole is thought to exert bactericidal activity.12,10

ADihydrofolate reductase
Escherichia coli (strain K12)

Steady-state concentrations are achieved after approximately 3 days of repeat administration.9 Average peak serum concentrations of approximately 1 µg/mL (Cmax) are achieved within 1 to 4 hours (Tmax) following the administration of a single 100mg dose.14 Trimethoprim appears to follow first-order pharmacokinetics,9 as a single 200mg dose results in serum concentrations approximately double that of a 100mg dose.14 The steady-state AUC of orally administered trimethoprim is approximately 30 mg/L·h.9

Volume of distribution

Trimethoprim is extensively distributed into various tissues following oral administration. It distributes well into sputum, middle ear fluid, and bronchial secretions.16 Trimethoprim distributes efficiently into vaginal fluids, with observed concentrations approximately 1.6-fold higher than those seen in the serum.14 It may pass the placental barrier and into breast milk.16 Trimethoprim is also sufficiently excreted in the feces to markedly reduce and/or eliminate trimethoprim-susceptible fecal flora.14

Protein binding

Trimethoprim is 44% bound to plasma proteins, though the specific proteins to which it binds have not been elucidated.13


Trimethoprim undergoes oxidative metabolism to a number of metabolites, the most abundant of which are the demethylated 3'- and 4'- metabolites, accounting for approximately 65% and 25% of the total metabolite formation, respectively.6 Minor products include N-oxide metabolites (<5%) and benzylic metabolites in even smaller quantities.6 The parent drug is considered to be the therapeutically active form.14

The majority of trimethoprim biotransformation appears to involve CYP2C9 and CYP3A4 enzymes, with CYP1A2 contributing to a lesser extent.6

Hover over products below to view reaction partners

Route of elimination

Approximately 10-20% of an ingested trimethoprim dose is metabolized, primarily in the liver, while a large portion of the remainder is excreted unchanged in the urine.14 Following oral administration, 50% to 60% of trimethoprim is excreted in the urine within 24 hours, approximately 80% of which is unchanged parent drug.13


Trimethoprim half-life ranges from 8-10 hours, but may be prolonged in patients with renal dysfunction.13


Following oral administration, the renal clearance of trimethoprim has been variably reported between 51.7 - 91.3 mL/min.9

Adverse Effects
Reduce medical errors
and improve treatment outcomes with our comprehensive & structured data on drug adverse effects.
Learn more
Reduce medical errors & improve treatment outcomes with our adverse effects data
Learn more

The oral LD50 in mice and rats is 2764 mg/kg and >5300 mg/kg, respectively.18

Prescribing information for trimethoprim states that signs of overdose may be evident following ingestion of doses >1 gram, and may include nausea, vomiting, dizziness, headaches, mental depression, confusion, and bone marrow depression.14 Treatment should consist of general supportive measures and gastric lavage, if applicable. Urinary acidification may increase renal elimination of trimethoprim. Hemodialysis is only moderately effective in eliminating trimethoprim and peritoneal dialysis is of no benefit.14

Not Available
Pharmacogenomic Effects/ADRs
Interacting Gene/EnzymeAllele nameGenotype(s)Defining Change(s)Type(s)DescriptionDetails
Glucose-6-phosphate 1-dehydrogenaseVilleurbanneNot Available1000_1002delACCADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseTorunNot Available1006A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSunderlandNot Available105_107delCATADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseIwatsukiNot Available1081G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSerresNot Available1082C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseTondelaNot Available1084_1101delCTGAACGAGCGCAAGGCCADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseLoma LindaNot Available1089C->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAachenNot Available1089C->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseTenriNot Available1096A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMontpellierNot Available1132G>AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseCalvo MackennaNot Available1138A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseRileyNot Available1139T->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseOlomoucNot Available1141T->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseTomahNot Available1153T->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseLynwoodNot Available1154G->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMadridNot Available1155C->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseIowa, Walter Reed, SpringfieldNot Available1156A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseBeverly Hills, Genova, Iwate, Niigata, YamaguchiNot Available1160G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseHartfordNot Available1162A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenasePrahaNot Available1166A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseKrakowNot Available1175T>CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseWisconsinNot Available1177C->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseNashville, Anaheim, PorticiNot Available1178G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAlhambraNot Available1180G->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseBariNot Available1187C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenasePuerto LimonNot Available1192G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseCovao do LoboNot Available1205C>AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseClinicNot Available1215G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseUtrechtNot Available1225C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSuwalkiNot Available1226C->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseRiversideNot Available1228G->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseJapan, ShinagawaNot Available1229G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseKawasakiNot Available1229G->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMunichNot Available1231A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseGeorgiaNot Available1284C->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSumareNot Available1292T->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseTelti/KobeNot Available1318C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSantiago de Cuba, MoriokaNot Available1339G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseHarimaNot Available1358T->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseFiguera da FozNot Available1366G->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAmiensNot Available1367A>TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseBangkok NoiNot Available1376G->T, 1502T->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseFukayaNot Available1462G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseCampinasNot Available1463G->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseBuenos AiresNot Available1465C>TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseArakawaNot Available1466C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseBrightonNot Available1488_1490delGAAADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseKozukataNot Available159G->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAmsterdamNot Available180_182delTCTADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseNo nameNot Available202G->A, 376A->G, 1264C>GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSwanseaNot Available224T->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseUrayasuNot Available281_283delAGAADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseVancouverNot Available317C->G544C->T592C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMt SinaiNot Available376A->G, 1159C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenasePlymouthNot Available488G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseVolendamNot Available514C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseShinshuNot Available527A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseChikugoNot Available535A->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseTsukuiNot Available561_563delCTCADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenasePedoplis-CkaroNot Available573C>GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSantiagoNot Available593G->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMinnesota, Marion, Gastonia, LeJeuneNot Available637G->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseCincinnatiNot Available637G->T, 1037A->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseHarilaouNot Available648T->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseNorth DallasNot Available683_685delACAADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAsahikawaNot Available695G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseDurhamNot Available713A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseStonybrookNot Available724_729delGGCACTADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseWayneNot Available769C->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAveiroNot Available806G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseCleveland CorumNot Available820G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseLilleNot Available821A>TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseBangkokNot Available825G>CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSugaoNot Available826C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseLa JollaNot Available832T->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseWexhamNot Available833C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenasePiotrkowNot Available851T>CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseWest VirginiaNot Available910G->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseOmiyaNot Available921G->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseNaraNot Available953_976delCCACCAAAGGGTACCTGGAC GACCADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseManhattanNot Available962G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseRehevotNot Available964T->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseHoniaraNot Available99A->G / 1360C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseTokyo, FukushimaNot Available1246G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseChathamNot Available1003G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseFushanNot Available1004C->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenasePartenopeNot Available1052G->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseIerapetraNot Available1057C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAnadiaNot Available1193A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAbenoNot Available1220A->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSurabayaNot Available1291G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenasePawneeNot Available1316G->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseS. AntiocoNot Available1342A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseCassanoNot Available1347G->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseHermoupolisNot Available1347G->C / 1360C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseUnion,Maewo, Chinese-2, KaloNot Available1360C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAndalusNot Available1361G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseCosenzaNot Available1376G->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseCanton, Taiwan- Hakka, Gifu-like, Agrigento-likeNot Available1376G->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseFloresNot Available1387C->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseKaiping, Anant, Dhon, Sapporo-like, WoseraNot Available1388G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseKamogawaNot Available169C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseCostanzoNot Available179T>CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAmazoniaNot Available185C->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSongklanagarindNot Available196T->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseHechiNot Available202G->A / 871G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseNamouruNot Available208T->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseBao LocNot Available352T>CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseCrispimNot Available375G->T, 379G->T383T->C384C>TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAcrokorinthosNot Available376A->G / 463C->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSanta MariaNot Available376A->G / 542A->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAnanindeuaNot Available376A->G / 871G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseVanua LavaNot Available383T->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseValladolidNot Available406C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseBelemNot Available409C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseLiuzhouNot Available442G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseShenzenNot Available473G>AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseTaipei “Chinese- 3”Not Available493A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseToledoNot Available496C>TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseNaoneNot Available497G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseNankangNot Available517T->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMiaoliNot Available519C->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMediterranean, Dallas, Panama‚ Sassari, Cagliari, BirminghamNot Available563C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseCoimbra ShundeNot Available592C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseNilgiriNot Available593G>AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseRadlowoNot Available679C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseRoubaixNot Available811G>CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseHaikouNot Available835A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseChinese-1Not Available835A->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMizushimaNot Available848A>GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseOsakaNot Available853C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseViangchan, JammuNot Available871G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSeoulNot Available916G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseLudhianaNot Available929G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseFarroupilhaNot Available977C->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseChinese-5Not Available1024C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseRignanoNot Available130G>AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseOrissaNot Available131C->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseG6PDNiceNot Available1380G>CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseKamiube, KeelungNot Available1387C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseNeapolisNot Available1400C->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAuresNot Available143T->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSplitNot Available1442C->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseKambosNot Available148C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenasePalestrinaNot Available170G>AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMetapontoNot Available172G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMusashinoNot Available185C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAsahiNot Available202G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseA- (202), Ferrara INot Available202G->A / 376A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMurcia OristanoNot Available209A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseUbe KonanNot Available241C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseLagosantoNot Available242G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseGuangzhouNot Available274C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseHammersmithNot Available323T->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSinnaiNot Available34G->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseA- (680)Not Available376A->G / 680G->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseA- (968), Betica,Selma, GuantanamoNot Available376A->G / 968T->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSalerno PyrgosNot Available383T>GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseQuing YanNot Available392G->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseLagesNot Available40G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseIleshaNot Available466G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMahidolNot Available487G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMalagaNot Available542A->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSibariNot Available634A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMexico CityNot Available680G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseNanningNot Available703C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSeattle, Lodi, Modena, Ferrara II, Athens-likeNot Available844G->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseBajo MaumereNot Available844G->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMontalbanoNot Available854G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseKalyan-Kerala, Jamnaga, RohiniNot Available949G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseGaoheNot Available95A->GADR InferredIncreased risk of dose-related hemolysis.Details


Drug Interactions
This information should not be interpreted without the help of a healthcare provider. If you believe you are experiencing an interaction, contact a healthcare provider immediately. The absence of an interaction does not necessarily mean no interactions exist.
AbacavirTrimethoprim may decrease the excretion rate of Abacavir which could result in a higher serum level.
AbametapirThe serum concentration of Trimethoprim can be increased when it is combined with Abametapir.
AbataceptThe metabolism of Trimethoprim can be increased when combined with Abatacept.
AbirateroneThe metabolism of Trimethoprim can be decreased when combined with Abiraterone.
AcebutololThe risk or severity of hyperkalemia can be increased when Trimethoprim is combined with Acebutolol.
AceclofenacAceclofenac may decrease the excretion rate of Trimethoprim which could result in a higher serum level.
AcemetacinAcemetacin may decrease the excretion rate of Trimethoprim which could result in a higher serum level.
AcenocoumarolThe metabolism of Acenocoumarol can be decreased when combined with Trimethoprim.
AcetaminophenAcetaminophen may decrease the excretion rate of Trimethoprim which could result in a higher serum level.
AcetazolamideThe therapeutic efficacy of Trimethoprim can be increased when used in combination with Acetazolamide.
Improve patient outcomes
Build effective decision support tools with the industry’s most comprehensive drug-drug interaction checker.
Learn more
Food Interactions
No interactions found.


Comprehensive & structured drug product info
From application numbers to product codes, connect different identifiers through our commercial datasets.
Learn more
Easily connect various identifiers back to our datasets
Learn more
Product Ingredients
IngredientUNIICASInChI Key
Trimethoprim hydrochloride9XE000OU9B60834-30-2YLCCEQZHUHUYPA-UHFFFAOYSA-N
Trimethoprim sulfateE377MF8EQ856585-33-2UILMMYFRNCCPLK-UHFFFAOYSA-N
Product Images
International/Other Brands
Alprim (Alphapharm) / Catin (Kojar) / Eumi (Hwang's) / Inflamnil (Swiss Pharm) / Lannacher (Root) / Lariago (Ipca Laboratories) / Meprim (Johnson) / Metipine (Kojar) / Monotrim (GlaxoSmithKline) / Motrim (Lannacher) / Trimpex / Triprim (GlaxoSmithKline)
Brand Name Prescription Products
NameDosageStrengthRouteLabellerMarketing StartMarketing EndRegionImage
PrimsolSolution50 mg/5mLOralAytu BioScience, Inc.2015-09-152018-01-01US flag
PrimSolSolution50 mg/5mLOralAllegis Holdings, Llc2017-05-04Not applicableUS flag
PrimsolSolution50 mg/5mLOralFsc Laboratories, Inc.2000-01-24Not applicableUS flag
ProloprimTablet200 mg/1OralMonarch Pharmaceuticals, Inc.1982-07-142007-01-31US flag
ProloprimTablet100 mg/1OralMonarch Pharmaceuticals, Inc.1982-07-142007-01-31US flag
Proloprim 200 Tab 200mgTabletOralGlaxosmithkline Inc1985-12-312004-08-05Canada flag
Proloprim Tab 100mgTabletOralGlaxosmithkline Inc1986-12-312003-10-28Canada flag
TrimethoprimTablet100 mg/1OralMayne Pharma2016-07-18Not applicableUS flag
TrimethoprimTablet200 mg/1OralTEVA PHARMACEUTICALS USA2006-11-062006-11-06US flag
TrimethoprimTablet100 mg/1OralTeva1990-09-302017-12-31US flag00093 2158 01 nlmimage10 5a2b2d69
Generic Prescription Products
NameDosageStrengthRouteLabellerMarketing StartMarketing EndRegionImage
TrimethoprimTablet100 mg/1OralActavis Pharma, Inc.2010-04-042019-03-31US flag0591 557120180907 15195 15kxnko
TrimethoprimTablet100 mg/1OralAv Kare, Inc.2013-05-06Not applicableUS flag
TrimethoprimTablet100 mg/1OralRemedy Repack2013-09-242014-09-24US flag
TrimethoprimTablet100 mg/1OralPD-Rx Pharmaceuticals, Inc.2010-04-042019-09-09US flag
TrimethoprimTablet100 mg/1OralLupin Pharmaceuticals,Inc.2011-06-24Not applicableUS flag
TrimethoprimTablet100 mg/1OralCarilion Materials Management2010-04-04Not applicableUS flag68151 201020180913 8702 1rmesn8
TrimethoprimTablet100 mg/1OralPhysicians Total Care, Inc.2012-05-02Not applicableUS flag00591 5571 01 nlmimage10 e0127053
TrimethoprimTablet100 mg/1OralAvPAK2013-07-312019-03-31US flag
TrimethoprimTablet100 mg/1Oralbryant ranch prepack2011-06-24Not applicableUS flag
TrimethoprimTablet100 mg/1OralNovel Laboratories, Inc.2014-03-04Not applicableUS flag
Mixture Products
NameIngredientsDosageRouteLabellerMarketing StartMarketing EndRegionImage
Apo-sulfatrim Oral SuspensionTrimethoprim (8 mg) + Sulfamethoxazole (40 mg)SuspensionOralApotex Corporation1989-12-31Not applicableCanada flag
BACTIGRAM F SUSPENSIÓNTrimethoprim (1600 mg) + Sulfamethoxazole (8000 mg)SuspensionOral2006-11-102021-07-01Colombia flag
BACTIGRAM- F COMPRIMIDOSTrimethoprim (160 mg) + Sulfamethoxazole (800 mg)TabletOral2006-11-102021-07-01Colombia flag
BactrimTrimethoprim (80 mg/1) + Sulfamethoxazole (400 mg/1)TabletOralSun Pharmaceutical Industries, Inc2004-11-01Not applicableUS flag
BactrimTrimethoprim (80 mg/1) + Sulfamethoxazole (400 mg/1)TabletOralAR Scientific, Inc.2004-11-012018-12-28US flag
BACTRIM 200/40 MG SUSPANSIYON, 100 MLTrimethoprim (40 mg/5ml) + Sulfamethoxazole (200 mg/5ml)SuspensionOralDeva Holding A.S.2020-08-14Not applicableTurkey flag
BACTRIM 400 MG/80 MG I.V. ENJEKSİYONLUK ÇÖZELTİ İÇEREN AMPUL, 1 ADETTrimethoprim (80 mg) + Sulfamethoxazole (400 mg)Injection, solutionIntravenousDeva Holding A.S.2020-08-14Not applicableTurkey flag
Bactrim DSTrimethoprim (160 mg/1) + Sulfamethoxazole (800 mg/1)TabletOralAdvanced Rx Pharmacy of Tennessee, LLC2010-09-13Not applicableUS flag
Bactrim DSTrimethoprim (160 mg/1) + Sulfamethoxazole (800 mg/1)TabletOralPhysicians Total Care, Inc.1997-08-26Not applicableUS flag
Bactrim DSTrimethoprim (160 mg/1) + Sulfamethoxazole (800 mg/1)TabletOralAdvanced Rx Pharmacy of Tennessee, LLC2010-02-16Not applicableUS flag
Unapproved/Other Products
NameIngredientsDosageRouteLabellerMarketing StartMarketing EndRegionImage
TRIMOKS FORT TABLET, 20 ADETTrimethoprim (160 mg) + Sulfamethoxazole (800 mg)TabletOralATABAY KİMYA SAN. VE TİC. A.Ş.2020-08-14Not applicableTurkey flag
TRIMOKS PED. 100 ML SUSPANSIYONTrimethoprim (80 mg) + Sulfamethoxazole (400 mg)SuspensionOralATABAY KİMYA SAN. VE TİC. A.Ş.2020-08-14Not applicableTurkey flag
TRIMOKS TABLET, 30 ADETTrimethoprim (80 mg) + Sulfamethoxazole (400 mg)TabletOralATABAY KİMYA SAN. VE TİC. A.Ş.2020-08-14Not applicableTurkey flag


ATC Codes
J01EE03 — Sulfametrole and trimethoprimJ01EA01 — TrimethoprimJ04AM08 — Isoniazid, sulfamethoxazole, trimethoprim and pyridoxineJ01EE01 — Sulfamethoxazole and trimethoprimJ01EE04 — Sulfamoxole and trimethoprimJ01EE02 — Sulfadiazine and trimethoprimJ01EE05 — Sulfadimidine and trimethoprimJ01EE07 — Sulfamerazine and trimethoprim
Drug Categories
Chemical TaxonomyProvided by Classyfire
This compound belongs to the class of organic compounds known as anisoles. These are organic compounds containing a methoxybenzene or a derivative thereof.
Organic compounds
Super Class
Phenol ethers
Sub Class
Direct Parent
Alternative Parents
Phenoxy compounds / Methoxybenzenes / Aminopyrimidines and derivatives / Alkyl aryl ethers / Imidolactams / Heteroaromatic compounds / Azacyclic compounds / Primary amines / Organopnictogen compounds / Hydrocarbon derivatives
Alkyl aryl ether / Amine / Aminopyrimidine / Anisole / Aromatic heteromonocyclic compound / Azacycle / Ether / Heteroaromatic compound / Hydrocarbon derivative / Imidolactam
Molecular Framework
Aromatic heteromonocyclic compounds
External Descriptors
aminopyrimidine, methoxybenzene (CHEBI:45924) / a small molecule (CPD0-1581)
Affected organisms
  • Staphylococcus saprophyticus
  • Escherichia coli
  • Proteus mirabilis
  • Klebsiella pneumoniae
  • Enterobacter spp.

Chemical Identifiers

CAS number
InChI Key


Synthesis Reference

Yasushi Takagishi, Kiichiro Ohsuga, Sadao Ohama, "Suppository containing sulfamethoxazole/trimethoprim complex and process for preparing the same." U.S. Patent US4461765, issued December, 1975.

General References
  1. Brumfitt W, Hamilton-Miller JM: Reassessment of the rationale for the combinations of sulphonamides with diaminopyrimidines. J Chemother. 1993 Dec;5(6):465-9. [Article]
  2. Brumfitt W, Hamilton-Miller JM: Limitations of and indications for the use of co-trimoxazole. J Chemother. 1994 Feb;6(1):3-11. [Article]
  3. Bean DC, Livermore DM, Papa I, Hall LM: Resistance among Escherichia coli to sulphonamides and other antimicrobials now little used in man. J Antimicrob Chemother. 2005 Nov;56(5):962-4. Epub 2005 Sep 8. [Article]
  4. Felmingham D, Reinert RR, Hirakata Y, Rodloff A: Increasing prevalence of antimicrobial resistance among isolates of Streptococcus pneumoniae from the PROTEKT surveillance study, and compatative in vitro activity of the ketolide, telithromycin. J Antimicrob Chemother. 2002 Sep;50 Suppl S1:25-37. [Article]
  5. Johnson JR, Manges AR, O'Bryan TT, Riley LW: A disseminated multidrug-resistant clonal group of uropathogenic Escherichia coli in pyelonephritis. Lancet. 2002 Jun 29;359(9325):2249-51. [Article]
  6. Goldman JL, Leeder JS, Van Haandel L, Pearce RE: In Vitro Hepatic Oxidative Biotransformation of Trimethoprim. Drug Metab Dispos. 2015 Sep;43(9):1372-80. doi: 10.1124/dmd.115.065193. Epub 2015 Jul 2. [Article]
  7. Kito T, Ito S, Mizuno T, Maeda K, Kusuhara H: Investigation of non-linear Mate1-mediated efflux of trimethoprim in the mouse kidney as the mechanism underlying drug-drug interactions between trimethoprim and organic cations in the kidney. Drug Metab Pharmacokinet. 2019 Feb;34(1):87-94. doi: 10.1016/j.dmpk.2018.08.005. Epub 2018 Sep 20. [Article]
  8. Misaka S, Knop J, Singer K, Hoier E, Keiser M, Muller F, Glaeser H, Konig J, Fromm MF: The Nonmetabolized beta-Blocker Nadolol Is a Substrate of OCT1, OCT2, MATE1, MATE2-K, and P-Glycoprotein, but Not of OATP1B1 and OATP1B3. Mol Pharm. 2016 Feb 1;13(2):512-9. doi: 10.1021/acs.molpharmaceut.5b00733. Epub 2016 Jan 19. [Article]
  9. Bergan T, Ortengren B, Westerlund D: Clinical pharmacokinetics of co-trimazine. Clin Pharmacokinet. 1986 Sep-Oct;11(5):372-86. doi: 10.2165/00003088-198611050-00003. [Article]
  10. Bushby SR: Synergy of trimethoprim-sulfamethoxazole. Can Med Assoc J. 1975 Jun 14;112(13 Spec No):63-6. [Article]
  11. Antibacterial Agents That Interfere With Folate Synthesis. (2020). In Rang and Dale's Pharmacology (9th ed.). Edinburgh: Elsevier. [ISBN:9780702080609]
  12. Health Canada Product Monograph: Polyrimethoprim (polymyxin B/trimethoprim) ophthalmic solution [Link]
  13. Health Canada Product Monograph: Trimethoprim oral tablets [Link]
  14. FDA Approved Drug Products: Trimethoprim oral tablets [Link]
  15. FDA Approved Drug Products: Primsol (trimethoprim) oral solution [Link]
  16. FDA Approved Drug Products: Bactrim (sulfamethoxazole/trimethoprim) oral tablets [Link]
  17. Health Canada Product Monograph: Septra (sulfamethoxazole/trimethoprim) for intravenous injection [Link]
  18. CaymanChem: Trimethoprim MSDS [Link]
  19. FDA Approved Drug Products: Sulfamethoxazole/Trimethoprim oral suspension [Link]
Human Metabolome Database
KEGG Compound
PubChem Compound
PubChem Substance
Therapeutic Targets Database
PDBe Ligand
RxList Drug Page Drug Page
AHFS Codes
  • 08:36.00 — Urinary Anti-infectives
PDB Entries
1dg5 / 1dyr / 2bfm / 2w3a / 2w3v / 2w9g / 2w9h / 2w9s / 3fl9 / 3frb
show 13 more
FDA label
Download (98.5 KB)

Clinical Trials

Clinical Trials
4CompletedEducational/Counseling/TrainingDiarrhea / Human Immunodeficiency Virus (HIV) Infections / Opportunistic Infections / Plasmodium Infections / Pneumonia1
4CompletedPreventionAcquired Immune Deficiency Syndrome (AIDS) / Anemia / Human Immunodeficiency Virus (HIV) Infections / Neutropenia / Newborn Infants1
4CompletedPreventionAllograft Rejection / Asymptomatic Bacteriuria / Hospitalizations / Microbiologic Resistance / Urinary Tract Infection1
4CompletedPreventionAntibiotic Side Effect / Human Immunodeficiency Virus Type 1 (HIV-1) Infection / Opportunistic Infections / Pneumocystis Jirovecii Pneumonia / Preventive Therapy1
4CompletedPreventionAsymptomatic Bacteriuria / Urinary Tract Infection1
4CompletedPreventionBacteriuria / Urinary Tract Infection1
4CompletedPreventionInfection Prophylaxis in Colo Rectal Surgery1
4CompletedPreventionPyelonephritis / Renal Scars1
4CompletedPreventionUrinary Tract Infections, Recurrent2
4CompletedTreatmentAcquired Immune Deficiency Syndrome (AIDS) / Toxoplasmic Encephalitis1


  • Monarch pharmaceuticals inc
  • Mutual pharmaceutical co inc
  • Teva pharmaceuticals usa inc
  • Watson laboratories inc
  • Hoffmann la roche inc
  • Fsc laboratories inc
  • Actavis Group
  • Advanced Pharmaceutical Services Inc.
  • Aidarex Pharmacuticals LLC
  • Akorn Inc.
  • Alcon Laboratories
  • Allergan Inc.
  • Amerisource Health Services Corp.
  • Amneal Pharmaceuticals
  • Apotheca Inc.
  • Apothecon
  • A-S Medication Solutions LLC
  • Ascent Pediatrics Inc.
  • Atlantic Biologicals Corporation
  • Aurobindo Pharma Ltd.
  • Avkare Incorporated
  • Bausch & Lomb Inc.
  • Baxter International Inc.
  • Bryant Ranch Prepack
  • Cardinal Health
  • Carlisle Laboratories Inc.
  • Casa De Amigos Pharmacy
  • Central Texas Community Health Centers
  • Comprehensive Consultant Services Inc.
  • Coupler Enterprises Inc.
  • Darby Dental Supply Co. Inc.
  • Dept Health Central Pharmacy
  • Direct Dispensing Inc.
  • Dispensing Solutions
  • Diversified Healthcare Services Inc.
  • Eon Labs
  • Falcon Pharmaceuticals Ltd.
  • FSC Laboratories
  • Golden State Medical Supply Inc.
  • Greenstone LLC
  • Group Health Cooperative
  • H.J. Harkins Co. Inc.
  • Heartland Repack Services LLC
  • Hi Tech Pharmacal Co. Inc.
  • Innovative Manufacturing and Distribution Services Inc.
  • Innoviant Pharmacy Inc.
  • Kaiser Foundation Hospital
  • Keltman Pharmaceuticals Inc.
  • King Pharmaceuticals Inc.
  • Laboratoires Docteur Pierre Ricaud
  • Lake Erie Medical and Surgical Supply
  • Lark Pharmaceuticals Inc.
  • Liberty Pharmaceuticals
  • Long Island Pharmacal
  • Lyne Laboratories Inc.
  • Major Pharmaceuticals
  • Mckesson Corp.
  • Medisca Inc.
  • Medvantx Inc.
  • Midland Healthcare LLC
  • Midland Pharmaceutical LLC
  • Monarch Pharmacy
  • Murfreesboro Pharmaceutical Nursing Supply
  • Mutual Pharmaceutical Co.
  • Novopharm Ltd.
  • Nucare Pharmaceuticals Inc.
  • Pacific Pharma Lp
  • Palmetto Pharmaceuticals Inc.
  • Patient First Corp.
  • PD-Rx Pharmaceuticals Inc.
  • Pfizer Animal Health
  • Pfizer Inc.
  • Pharmaceutical Association
  • Pharmaceutical Utilization Management Program VA Inc.
  • Pharmacia Inc.
  • Pharmedix
  • Physicians Total Care Inc.
  • Pliva Inc.
  • Preferred Pharmaceuticals Inc.
  • Prepackage Specialists
  • Prepak Systems Inc.
  • Prescript Pharmaceuticals
  • Qualitest
  • Rebel Distributors Corp.
  • Redpharm Drug
  • Remedy Repack
  • Resource Optimization and Innovation LLC
  • Sandhills Packaging Inc.
  • Sandoz
  • Sicor Pharmaceuticals
  • Southwood Pharmaceuticals
  • St Mary's Medical Park Pharmacy
  • Stat Scripts LLC
  • Talbert Medical Management Corp.
  • Taro Pharmaceuticals USA
  • Taylor Pharmaceuticals
  • Teva Pharmaceutical Industries Ltd.
  • Tya Pharmaceuticals
  • UDL Laboratories
  • United Research Laboratories Inc.
  • Va Cmop Dallas
  • Vangard Labs Inc.
  • Vintage Pharmaceuticals Inc.
  • Vista Pharmaceuticals Inc.
  • Watson Pharmaceuticals
  • Women First Healthcare Inc.
  • Xactdose Inc.
Dosage Forms
TabletOral400 MG
TabletOral800 MG
Tablet, solubleOral800 MG
Injection, solutionIntravenous
Injection, solution, concentrateIntramuscular; Intravenous
Injection, solution
SolutionConjunctival; Ophthalmic
Solution / dropsOphthalmic
Capsule, coatedOral
SolutionOral50 mg/5mL
TabletOral100 mg/1
TabletOral200 mg/1
Powder, for solutionOral
Tablet, solubleOral
Injection, solution, concentrateIntravenous
PowderNot applicable1 g/1g
Injection, solutionIntramuscular; Intravenous
Tablet, delayed releaseOral
Powder, for suspensionOral
Tablet, coatedOral
Tablet, film coatedOral
Tablet, sugar coatedOral
TabletOral200 mg
Unit descriptionCostUnit
Bactrim ds tablet5.53USD tablet
Bactrim DS 800-160 mg tablet3.0USD tablet
Septra DS 800-160 mg tablet2.43USD tablet
Septra ds tablet2.33USD tablet
Trimethoprim powder1.79USD g
Bactrim 400-80 mg tablet1.63USD tablet
Septra 80-400 tablet1.49USD tablet
Sulfamethoxazole-tmp ds tablet1.44USD tablet
Sulfamethoxazole-tmp vial0.84USD ml
Trimethoprim 100 mg tablet0.7USD tablet
Sulfamethoxazole-Trimethoprim 400-80 mg tablet0.69USD tablet
Apo-Trimethoprim 200 mg Tablet0.55USD tablet
Primsol 50 mg/5 ml oral soln0.39USD ml
Apo-Trimethoprim 100 mg Tablet0.27USD tablet
Sulfamethoxazole-tmp ss tablet0.17USD tablet
Sulfamethoxazole-Trimethoprim 200-40 mg/5ml Suspension0.13USD ml
Sulfatrim 200-40 mg/5ml Suspension0.13USD ml
DrugBank does not sell nor buy drugs. Pricing information is supplied for informational purposes only.
Patent NumberPediatric ExtensionApprovedExpires (estimated)Region
US5962461No1999-10-052016-08-07US flag
US5763449No1998-06-092016-08-07US flag


Experimental Properties
melting point (°C)199-203 °CPhysProp
water solubility400 mg/L (at 25 °C)YALKOWSKY,SH & DANNENFELSER,RM (1992)
logP0.91HANSCH,C ET AL. (1995)
logS-2.86ADME Research, USCD
pKa7.12 (at 20 °C)PERRIN,DD (1972)
Predicted Properties
Water Solubility0.615 mg/mLALOGPS
pKa (Strongest Acidic)17.33ChemAxon
pKa (Strongest Basic)7.16ChemAxon
Physiological Charge1ChemAxon
Hydrogen Acceptor Count7ChemAxon
Hydrogen Donor Count2ChemAxon
Polar Surface Area105.51 Å2ChemAxon
Rotatable Bond Count5ChemAxon
Refractivity81.51 m3·mol-1ChemAxon
Polarizability29.71 Å3ChemAxon
Number of Rings2ChemAxon
Rule of FiveYesChemAxon
Ghose FilterYesChemAxon
Veber's RuleNoChemAxon
MDDR-like RuleNoChemAxon
Predicted ADMET Features
Human Intestinal Absorption+0.994
Blood Brain Barrier+0.9381
Caco-2 permeable+0.8867
P-glycoprotein substrateNon-substrate0.5845
P-glycoprotein inhibitor INon-inhibitor0.8631
P-glycoprotein inhibitor IINon-inhibitor0.8382
Renal organic cation transporterNon-inhibitor0.8531
CYP450 2C9 substrateNon-substrate0.8799
CYP450 2D6 substrateNon-substrate0.9116
CYP450 3A4 substrateNon-substrate0.5732
CYP450 1A2 substrateNon-inhibitor0.9046
CYP450 2C9 inhibitorNon-inhibitor0.9071
CYP450 2D6 inhibitorNon-inhibitor0.9231
CYP450 2C19 inhibitorNon-inhibitor0.9025
CYP450 3A4 inhibitorNon-inhibitor0.8467
CYP450 inhibitory promiscuityHigh CYP Inhibitory Promiscuity0.5
Ames testNon AMES toxic0.8227
BiodegradationNot ready biodegradable0.9949
Rat acute toxicity1.7701 LD50, mol/kg Not applicable
hERG inhibition (predictor I)Weak inhibitor0.9394
hERG inhibition (predictor II)Non-inhibitor0.8734
ADMET data is predicted using admetSAR, a free tool for evaluating chemical ADMET properties. (23092397)


Mass Spec (NIST)
Not Available
SpectrumSpectrum TypeSplash Key
Predicted GC-MS Spectrum - GC-MSPredicted GC-MSNot Available
GC-MS Spectrum - EI-BGC-MSsplash10-0006-5390000000-e68103f64cbb997e5776
Predicted MS/MS Spectrum - 10V, Positive (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 20V, Positive (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 40V, Positive (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 10V, Negative (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 20V, Negative (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 40V, Negative (Annotated)Predicted LC-MS/MSNot Available
LC-MS/MS Spectrum - LC-ESI-qTof , PositiveLC-MS/MSNot Available
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-0089-0290000000-32000410829186ca112c
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-0006-0090000000-44ccaa9725303a7db8a4
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-0006-0090000000-af77a44791c8867aad66
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-0006-0190000000-8eb1449e3f800368c863
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-03n9-0190000000-deb1664d211c2227b048
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-077i-0590000000-ae48b54f4879c1551670
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-0089-1950000000-5084ea4b328a585b675d
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-0006-0090000000-fb9fa4e4130917b6e6ff
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-0006-0090000000-15d83f92b30f466cd587
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-0006-0190000000-f95e0c038a6aa70dc02e
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-03na-0190000000-72c88d8f9739c7d29714
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-077i-0590000000-9c0f5662b9713adab9cb
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-0089-1950000000-8b16041ba3b127d299ba
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-0089-0290000000-6a16da6c03a03fd87f34
LC-MS/MS Spectrum - LC-ESI-QQ , positiveLC-MS/MSsplash10-0006-0090000000-145bf44afce31ab82f64
LC-MS/MS Spectrum - LC-ESI-QQ , positiveLC-MS/MSsplash10-0006-0090000000-68ca013641f0c338b3a2
LC-MS/MS Spectrum - LC-ESI-QQ , positiveLC-MS/MSsplash10-008c-0290000000-d56028ecf88d373b83bd
LC-MS/MS Spectrum - LC-ESI-QQ , positiveLC-MS/MSsplash10-03n9-0590000000-15246e14a33089adf87d
LC-MS/MS Spectrum - LC-ESI-QQ , positiveLC-MS/MSsplash10-0230-1950000000-83b1288780d0f8f7b8a4
LC-MS/MS Spectrum - LC-ESI-IT , positiveLC-MS/MSsplash10-00e9-0690000000-693e14cc9adc7eb2f25a
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-01si-0190000000-1cf9183ddf2bfed27ff3
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-0259-0590000000-114c45037d358307bf34
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-0006-0190000000-ef1516809b4a9fc2cb85
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-0089-0290000000-a1cc2a930cf072c3aa11
MS/MS Spectrum - , positiveLC-MS/MSsplash10-0006-0190000000-0fa04011b512afabef25
MS/MS Spectrum - , positiveLC-MS/MSsplash10-0006-0090000000-2e8d981761670d12c381
MS/MS Spectrum - , positiveLC-MS/MSsplash10-03na-2690000000-39babdc7b45a0aa0adf7


Accelerate your drug discovery research
with our fully connected ADMET & drug target dataset.
Learn more
Accelerate your drug discovery research with our ADMET & drug target dataset
Learn more
1. Dihydrofolate reductase
Escherichia coli (strain K12)
Pharmacological action
Curator comments
Note: The above was chosen as a representative target protein in a representative bacterium, and does not encompass all proteins/bacteria affected by this agent.
General Function
Nadp binding
Specific Function
Key enzyme in folate metabolism. Catalyzes an essential reaction for de novo glycine and purine synthesis, and for DNA precursor synthesis.
Gene Name
Uniprot ID
Uniprot Name
Dihydrofolate reductase
Molecular Weight
17999.21 Da
  1. Laskowska E, Kuczynska-Wisnik D, Bak M, Lipinska B: Trimethoprim induces heat shock proteins and protein aggregation in E. coli cells. Curr Microbiol. 2003 Oct;47(4):286-9. [Article]
  2. Rosowsky A, Fu H, Chan DC, Queener SF: Synthesis of 2,4-diamino-6-[2'-O-(omega-carboxyalkyl)oxydibenz[b,f]azepin-5-yl]methylpteridine s as potent and selective inhibitors of Pneumocystis carinii, Toxoplasma gondii, and Mycobacterium avium dihydrofolate reductase. J Med Chem. 2004 May 6;47(10):2475-85. [Article]
  3. Nahimana A, Rabodonirina M, Bille J, Francioli P, Hauser PM: Mutations of Pneumocystis jirovecii dihydrofolate reductase associated with failure of prophylaxis. Antimicrob Agents Chemother. 2004 Nov;48(11):4301-5. [Article]
  4. Barrow EW, Bourne PC, Barrow WW: Functional cloning of Bacillus anthracis dihydrofolate reductase and confirmation of natural resistance to trimethoprim. Antimicrob Agents Chemother. 2004 Dec;48(12):4643-9. [Article]
  5. FDA Approved Drug Products: Bactrim (sulfamethoxazole and trimethoprim) [Link]


Pharmacological action
General Function
Steroid hydroxylase activity
Specific Function
Cytochromes P450 are a group of heme-thiolate monooxygenases. In liver microsomes, this enzyme is involved in an NADPH-dependent electron transport pathway. It oxidizes a variety of structurally un...
Gene Name
Uniprot ID
Uniprot Name
Cytochrome P450 2C9
Molecular Weight
55627.365 Da
  1. Rendic S: Summary of information on human CYP enzymes: human P450 metabolism data. Drug Metab Rev. 2002 Feb-May;34(1-2):83-448. [Article]
  2. Wen X, Wang JS, Backman JT, Laitila J, Neuvonen PJ: Trimethoprim and sulfamethoxazole are selective inhibitors of CYP2C8 and CYP2C9, respectively. Drug Metab Dispos. 2002 Jun;30(6):631-5. doi: 10.1124/dmd.30.6.631. [Article]
  3. Goldman JL, Leeder JS, Van Haandel L, Pearce RE: In Vitro Hepatic Oxidative Biotransformation of Trimethoprim. Drug Metab Dispos. 2015 Sep;43(9):1372-80. doi: 10.1124/dmd.115.065193. Epub 2015 Jul 2. [Article]
Pharmacological action
General Function
Vitamin d3 25-hydroxylase activity
Specific Function
Cytochromes P450 are a group of heme-thiolate monooxygenases. In liver microsomes, this enzyme is involved in an NADPH-dependent electron transport pathway. It performs a variety of oxidation react...
Gene Name
Uniprot ID
Uniprot Name
Cytochrome P450 3A4
Molecular Weight
57342.67 Da
  1. Rendic S: Summary of information on human CYP enzymes: human P450 metabolism data. Drug Metab Rev. 2002 Feb-May;34(1-2):83-448. [Article]
  2. Goldman JL, Leeder JS, Van Haandel L, Pearce RE: In Vitro Hepatic Oxidative Biotransformation of Trimethoprim. Drug Metab Dispos. 2015 Sep;43(9):1372-80. doi: 10.1124/dmd.115.065193. Epub 2015 Jul 2. [Article]
Pharmacological action
General Function
Oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen
Specific Function
Cytochromes P450 are a group of heme-thiolate monooxygenases. In liver microsomes, this enzyme is involved in an NADPH-dependent electron transport pathway. It oxidizes a variety of structurally un...
Gene Name
Uniprot ID
Uniprot Name
Cytochrome P450 1A2
Molecular Weight
58293.76 Da
  1. Goldman JL, Leeder JS, Van Haandel L, Pearce RE: In Vitro Hepatic Oxidative Biotransformation of Trimethoprim. Drug Metab Dispos. 2015 Sep;43(9):1372-80. doi: 10.1124/dmd.115.065193. Epub 2015 Jul 2. [Article]
Pharmacological action
General Function
Steroid hydroxylase activity
Specific Function
Cytochromes P450 are a group of heme-thiolate monooxygenases. In liver microsomes, this enzyme is involved in an NADPH-dependent electron transport pathway. It oxidizes a variety of structurally un...
Gene Name
Uniprot ID
Uniprot Name
Cytochrome P450 2C8
Molecular Weight
55824.275 Da
  1. Wen X, Wang JS, Backman JT, Laitila J, Neuvonen PJ: Trimethoprim and sulfamethoxazole are selective inhibitors of CYP2C8 and CYP2C9, respectively. Drug Metab Dispos. 2002 Jun;30(6):631-5. doi: 10.1124/dmd.30.6.631. [Article]
  2. Rendic S: Summary of information on human CYP enzymes: human P450 metabolism data. Drug Metab Rev. 2002 Feb-May;34(1-2):83-448. [Article]
  3. Trimethoprim FDA label [File]


Pharmacological action
General Function
Xenobiotic-transporting atpase activity
Specific Function
Energy-dependent efflux pump responsible for decreased drug accumulation in multidrug-resistant cells.
Gene Name
Uniprot ID
Uniprot Name
Multidrug resistance protein 1
Molecular Weight
141477.255 Da
  1. Susanto M, Benet LZ: Can the enhanced renal clearance of antibiotics in cystic fibrosis patients be explained by P-glycoprotein transport? Pharm Res. 2002 Apr;19(4):457-62. doi: 10.1023/a:1015191511817. [Article]
  2. Park MS, Okochi H, Benet LZ: Is Ciprofloxacin a Substrate of P-glycoprotein? Arch Drug Inf. 2011 Mar;4(1):1-9. doi: 10.1111/j.1753-5174.2010.00032.x. [Article]
  3. FDA Approved Drug Products: Bactrim (sulfamethoxazole/trimethoprim) oral tablets [Link]
Pharmacological action
General Function
Monovalent cation:proton antiporter activity
Specific Function
Solute transporter for tetraethylammonium (TEA), 1-methyl-4-phenylpyridinium (MPP), cimetidine, N-methylnicotinamide (NMN), metformin, creatinine, guanidine, procainamide, topotecan, estrone sulfat...
Gene Name
Uniprot ID
Uniprot Name
Multidrug and toxin extrusion protein 1
Molecular Weight
61921.585 Da
  1. Kito T, Ito S, Mizuno T, Maeda K, Kusuhara H: Investigation of non-linear Mate1-mediated efflux of trimethoprim in the mouse kidney as the mechanism underlying drug-drug interactions between trimethoprim and organic cations in the kidney. Drug Metab Pharmacokinet. 2019 Feb;34(1):87-94. doi: 10.1016/j.dmpk.2018.08.005. Epub 2018 Sep 20. [Article]
  2. Elsby R, Chidlaw S, Outteridge S, Pickering S, Radcliffe A, Sullivan R, Jones H, Butler P: Mechanistic in vitro studies confirm that inhibition of the renal apical efflux transporter multidrug and toxin extrusion (MATE) 1, and not altered absorption, underlies the increased metformin exposure observed in clinical interactions with cimetidine, trimethoprim or pyrimethamine. Pharmacol Res Perspect. 2017 Oct;5(5). doi: 10.1002/prp2.357. [Article]
  3. Misaka S, Knop J, Singer K, Hoier E, Keiser M, Muller F, Glaeser H, Konig J, Fromm MF: The Nonmetabolized beta-Blocker Nadolol Is a Substrate of OCT1, OCT2, MATE1, MATE2-K, and P-Glycoprotein, but Not of OATP1B1 and OATP1B3. Mol Pharm. 2016 Feb 1;13(2):512-9. doi: 10.1021/acs.molpharmaceut.5b00733. Epub 2016 Jan 19. [Article]
Pharmacological action
General Function
Drug transmembrane transporter activity
Specific Function
Solute transporter for tetraethylammonium (TEA), 1-methyl-4-phenylpyridinium (MPP), cimetidine, N-methylnicotinamide, metformin, creatinine, guanidine, procainamide, topotecan, estrone sulfate, acy...
Gene Name
Uniprot ID
Uniprot Name
Multidrug and toxin extrusion protein 2
Molecular Weight
65083.915 Da
  1. Kito T, Ito S, Mizuno T, Maeda K, Kusuhara H: Investigation of non-linear Mate1-mediated efflux of trimethoprim in the mouse kidney as the mechanism underlying drug-drug interactions between trimethoprim and organic cations in the kidney. Drug Metab Pharmacokinet. 2019 Feb;34(1):87-94. doi: 10.1016/j.dmpk.2018.08.005. Epub 2018 Sep 20. [Article]
  2. Misaka S, Knop J, Singer K, Hoier E, Keiser M, Muller F, Glaeser H, Konig J, Fromm MF: The Nonmetabolized beta-Blocker Nadolol Is a Substrate of OCT1, OCT2, MATE1, MATE2-K, and P-Glycoprotein, but Not of OATP1B1 and OATP1B3. Mol Pharm. 2016 Feb 1;13(2):512-9. doi: 10.1021/acs.molpharmaceut.5b00733. Epub 2016 Jan 19. [Article]

Drug created on June 13, 2005 13:24 / Updated on May 11, 2021 01:03