


Sulfamethoxazole is an oral sulfonamide antibiotic, given in combination with trimethoprim, used to treat a variety of infections of the urinary tract, respiratory system, and gastrointestinal tract.

Brand Names
Bactrim, Septra, Sulfatrim
Generic Name
DrugBank Accession Number

Sulfamethoxazole is a bacteriostatic sulfonamide antibiotic that interferes with folic acid synthesis in susceptible bacteria.9 It is generally given in combination with trimethoprim, which inhibits a sequential step in bacterial folic acid synthesis - these agents work synergistically to block two consecutive steps in the biosynthesis of nucleic acids and proteins which are necessary for bacterial growth and division, and using them in conjunction helps to slow the development of bacterial resistance.9 In this combination, sulfamethoxazole is useful for the treatment of a variety of bacterial infections, including those of the urinary, respiratory, and gastrointestinal tracts.

Small Molecule
Average: 253.278
Monoisotopic: 253.052111923
Chemical Formula
  • 3-(p-Aminophenylsulfonamido)-5-methylisoxazole
  • 3-Sulfanilamido-5-methylisoxazole
  • 4-Amino-N-(5-methyl-3-isoxazolyl)benzenesulfonamide
  • SMX
  • Sulfamethoxazole
  • Sulfametoxazol
  • Sulphamethoxazole
External IDs
  • NSC-147832
  • RO 4-2130
  • STX-608



Sulfamethoxazole is indicated in combination with trimethoprim, in various formulations, for the following infections caused by bacteria with documented susceptibility: urinary tract infections, acute otitis media in pediatric patients (when clinically indicated), acute exacerbations of chronic bronchitis in adults, enteritis caused by susceptible Shigella, prophylaxis and treatment of Pneumocystis jiroveci pneumonia, and travelers' diarrhea caused by enterotoxigenic E. coli.9,11

In Canada, additional indications include the adjunctive treatment of cholera, treatment of bacillary dysentery, nocardiosis, and second-line treatment of brucellosis in combination with gentamicin or rifampicin.10

Reduce drug development failure rates
Build, train, & validate machine-learning models
with evidence-based and structured datasets.
See how
Build, train, & validate predictive machine-learning models with structured datasets.
See how
Associated Conditions
Contraindications & Blackbox Warnings
Avoid life-threatening adverse drug events
Improve clinical decision support with information on contraindications & blackbox warnings, population restrictions, harmful risks, & more.
Learn more
Avoid life-threatening adverse drug events & improve clinical decision support.
Learn more

Sulfamethoxazole is a bacteriostatic sulfonamide antibiotic that inhibits a critical step in bacterial folate synthesis. It is generally given in combination with trimethoprim, a dihydrofolate reductase inhibitor, which inhibits the reduction of dihydrofolic acid to tetrahydrofolic acid.9 Studies have shown that bacterial resistance develops more slowly with the combination of the two drugs than with either trimethoprim or sulfamethoxazole alone, as together they inhibit sequential steps in the bacterial folate synthesis pathway.9

Sulfonamides, including sulfamethoxazole, have been implicated in hypersensitivity reactions - these agents should be discontinued at the first sign of a developing rash, as this may signal the start of a more severe reaction such as Stevens-Johnson syndrome or toxic epidermal necrolysis. Sulfamethoxazole treatment may contribute to folate deficiency and should therefore be used with caution in patients at a higher risk of developing a deficiency. Hemolysis has been observed in patients with glucose-6-phosphate dehydrogenase deficiency who are using sulfamethoxazole/trimethoprim.9

Mechanism of action

Sulfamethoxazole is a sulfonamide that inhibits bacterial dihydrofolic acid synthesis due to its structural similarity to an endogenous substrate, para-aminobenzoic acid (PABA).1,2 Most bacteria meet their need for folic acid by synthesizing it from PABA, as opposed to Animalia that require exogenous folic acid sources.10 Sulfamethoxazole competitively inhibits dihydropteroate synthase, the enzyme responsible for bacterial conversion of PABA to dihydrofolic acid.3 Inhibition of this pathway prevents the synthesis of tetrahydrofolate and, ultimately, the synthesis of bacterial purines and DNA, resulting in a bacteriostatic effect.4

ADihydropteroate synthase
Escherichia coli (strain K12)

Sulfamethoxazole is rapidly absorbed following oral administration and has a bioavailability of 85-90%.5 The Tmax is approximately 1-4 hours following oral administration, and the Cmax at steady-state is 57.4 - 68.0 μg/mL.9

Volume of distribution

The volume of distribution sulfamethoxazole following a single oral dose was found to be 13 L.5 Sulfamethoxazole distributes into sputum, vaginal fluid, middle ear fluid, breast milk, and the placenta.9

Protein binding

Sulfamethoxazole is approximately 70% bound to plasma proteins,9 primarily to albumin.10


Sulfamethoxazole metabolism is mediated primarily by arylamine N-acetyltransferase (NAT) enzymes, which are responsible for acetylation of sulfamethoxazole at its N4 position.7,9 Sulfamethoxazole may also undergo oxidation at its C5 and N4 atoms, the latter of which is catalyzed by CYP2C9.9 Glucuronidation of the N4 atom, likely mediated by unspecified UGT enzymes, is an additional minor route of metabolism.7 None of the identified metabolites of sulfamethoxazole appear to carry antimicrobial activity.9

The hydroxylamine metabolite of sulfamethoxazole, generated via oxidation by CYP2C9, may be further converted to a more reactive nitroso- metabolite.7

Hover over products below to view reaction partners

Route of elimination

Elimination occurs primarily via glomerular filtration and tubular secretion in the kidneys, with urine concentrations generally considerably higher than plasma concentrations.9 Approximately 84.5% of a single oral dose of sulfamethoxazole is recovered in the urine within 72 hours, of which ~30% is free sulfamethoxazole and the remainder is the N4-acetylated metabolite.9


The average serum half-life of sulfamethoxazole is 10 hours and may be increased in patients with severely impaired renal function.9


The oral and renal clearance of sulfamethoxazole have been estimated as 1.2 ± 0.2 and 0.22 ± 0.05 L/h, respectively.8

Adverse Effects
Improve decision support & research outcomes
With structured adverse effects data, including: blackbox warnings, adverse reactions, warning & precautions, & incidence rates.
Learn more
Improve decision support & research outcomes with our structured adverse effects data.
Learn more

The oral LD50 of sulfamethoxazole in mice and rats is 2300 mg/kg and 6200 mg/kg, respectively.12

Signs or symptoms of sulfonamide overdose include anorexia, colic, nausea, vomiting, dizziness, headache, drowsiness, and unconsciousness. Less common symptoms may include pyrexia, hematuria, and crystalluria. Later manifestations of overdose may include blood dyscrasias and jaundice.9 Treatment should be symptomatic and supportive, and may include gastric lavage or forced emesis if applicable. Monitor patient lab work for evidence of blood dyscrasias or electrolyte imbalances.9

Not Available
Pharmacogenomic Effects/ADRs
Interacting Gene/EnzymeAllele nameGenotype(s)Defining Change(s)Type(s)DescriptionDetails
Glucose-6-phosphate 1-dehydrogenaseVilleurbanneNot Available1000_1002delACCADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseTorunNot Available1006A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSunderlandNot Available105_107delCATADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseIwatsukiNot Available1081G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSerresNot Available1082C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseTondelaNot Available1084_1101delCTGAACGAGCGCAAGGCCADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseLoma LindaNot Available1089C->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAachenNot Available1089C->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseTenriNot Available1096A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMontpellierNot Available1132G>AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseCalvo MackennaNot Available1138A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseRileyNot Available1139T->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseOlomoucNot Available1141T->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseTomahNot Available1153T->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseLynwoodNot Available1154G->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMadridNot Available1155C->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseIowa, Walter Reed, SpringfieldNot Available1156A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseBeverly Hills, Genova, Iwate, Niigata, YamaguchiNot Available1160G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseHartfordNot Available1162A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenasePrahaNot Available1166A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseKrakowNot Available1175T>CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseWisconsinNot Available1177C->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseNashville, Anaheim, PorticiNot Available1178G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAlhambraNot Available1180G->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseBariNot Available1187C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenasePuerto LimonNot Available1192G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseCovao do LoboNot Available1205C>AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseClinicNot Available1215G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseUtrechtNot Available1225C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSuwalkiNot Available1226C->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseRiversideNot Available1228G->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseJapan, ShinagawaNot Available1229G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseKawasakiNot Available1229G->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMunichNot Available1231A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseGeorgiaNot Available1284C->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSumareNot Available1292T->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseTelti/KobeNot Available1318C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSantiago de Cuba, MoriokaNot Available1339G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseHarimaNot Available1358T->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseFiguera da FozNot Available1366G->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAmiensNot Available1367A>TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseBangkok NoiNot Available1376G->T, 1502T->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseFukayaNot Available1462G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseCampinasNot Available1463G->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseBuenos AiresNot Available1465C>TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseArakawaNot Available1466C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseBrightonNot Available1488_1490delGAAADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseKozukataNot Available159G->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAmsterdamNot Available180_182delTCTADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseNo nameNot Available202G->A, 376A->G, 1264C>GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSwanseaNot Available224T->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseUrayasuNot Available281_283delAGAADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseVancouverNot Available317C->G544C->T592C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMt SinaiNot Available376A->G, 1159C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenasePlymouthNot Available488G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseVolendamNot Available514C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseShinshuNot Available527A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseChikugoNot Available535A->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseTsukuiNot Available561_563delCTCADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenasePedoplis-CkaroNot Available573C>GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSantiagoNot Available593G->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMinnesota, Marion, Gastonia, LeJeuneNot Available637G->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseCincinnatiNot Available637G->T, 1037A->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseHarilaouNot Available648T->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseNorth DallasNot Available683_685delACAADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAsahikawaNot Available695G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseDurhamNot Available713A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseStonybrookNot Available724_729delGGCACTADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseWayneNot Available769C->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAveiroNot Available806G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseCleveland CorumNot Available820G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseLilleNot Available821A>TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseBangkokNot Available825G>CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSugaoNot Available826C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseLa JollaNot Available832T->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseWexhamNot Available833C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenasePiotrkowNot Available851T>CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseWest VirginiaNot Available910G->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseOmiyaNot Available921G->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseNaraNot Available953_976delCCACCAAAGGGTACCTGGAC GACCADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseManhattanNot Available962G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseRehevotNot Available964T->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseHoniaraNot Available99A->G / 1360C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseTokyo, FukushimaNot Available1246G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseChathamNot Available1003G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseFushanNot Available1004C->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenasePartenopeNot Available1052G->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseIerapetraNot Available1057C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAnadiaNot Available1193A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAbenoNot Available1220A->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSurabayaNot Available1291G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenasePawneeNot Available1316G->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseS. AntiocoNot Available1342A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseCassanoNot Available1347G->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseHermoupolisNot Available1347G->C / 1360C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseUnion,Maewo, Chinese-2, KaloNot Available1360C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAndalusNot Available1361G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseCosenzaNot Available1376G->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseCanton, Taiwan- Hakka, Gifu-like, Agrigento-likeNot Available1376G->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseFloresNot Available1387C->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseKaiping, Anant, Dhon, Sapporo-like, WoseraNot Available1388G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseKamogawaNot Available169C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseCostanzoNot Available179T>CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAmazoniaNot Available185C->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSongklanagarindNot Available196T->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseHechiNot Available202G->A / 871G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseNamouruNot Available208T->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseBao LocNot Available352T>CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseCrispimNot Available375G->T, 379G->T383T->C384C>TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAcrokorinthosNot Available376A->G / 463C->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSanta MariaNot Available376A->G / 542A->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAnanindeuaNot Available376A->G / 871G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseVanua LavaNot Available383T->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseValladolidNot Available406C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseBelemNot Available409C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseLiuzhouNot Available442G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseShenzenNot Available473G>AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseTaipei “Chinese- 3”Not Available493A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseToledoNot Available496C>TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseNaoneNot Available497G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseNankangNot Available517T->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMiaoliNot Available519C->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMediterranean, Dallas, Panama‚ Sassari, Cagliari, BirminghamNot Available563C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseCoimbra ShundeNot Available592C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseNilgiriNot Available593G>AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseRadlowoNot Available679C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseRoubaixNot Available811G>CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseHaikouNot Available835A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseChinese-1Not Available835A->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMizushimaNot Available848A>GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseOsakaNot Available853C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseViangchan, JammuNot Available871G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSeoulNot Available916G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseLudhianaNot Available929G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseFarroupilhaNot Available977C->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseChinese-5Not Available1024C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseRignanoNot Available130G>AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseOrissaNot Available131C->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseG6PDNiceNot Available1380G>CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseKamiube, KeelungNot Available1387C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseNeapolisNot Available1400C->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAuresNot Available143T->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSplitNot Available1442C->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseKambosNot Available148C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenasePalestrinaNot Available170G>AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMetapontoNot Available172G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMusashinoNot Available185C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAsahiNot Available202G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseA- (202), Ferrara INot Available202G->A / 376A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMurcia OristanoNot Available209A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseUbe KonanNot Available241C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseLagosantoNot Available242G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseGuangzhouNot Available274C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseHammersmithNot Available323T->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSinnaiNot Available34G->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseA- (680)Not Available376A->G / 680G->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseA- (968), Betica,Selma, GuantanamoNot Available376A->G / 968T->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSalerno PyrgosNot Available383T>GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseQuing YanNot Available392G->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseLagesNot Available40G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseIleshaNot Available466G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMahidolNot Available487G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMalagaNot Available542A->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSibariNot Available634A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMexico CityNot Available680G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseNanningNot Available703C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSeattle, Lodi, Modena, Ferrara II, Athens-likeNot Available844G->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseBajo MaumereNot Available844G->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMontalbanoNot Available854G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseKalyan-Kerala, Jamnaga, RohiniNot Available949G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseGaoheNot Available95A->GADR InferredIncreased risk of dose-related hemolysis.Details


Drug Interactions
This information should not be interpreted without the help of a healthcare provider. If you believe you are experiencing an interaction, contact a healthcare provider immediately. The absence of an interaction does not necessarily mean no interactions exist.
AbacavirSulfamethoxazole may decrease the excretion rate of Abacavir which could result in a higher serum level.
AbataceptThe risk or severity of myelosuppression can be increased when Sulfamethoxazole is combined with Abatacept.
AbemaciclibThe metabolism of Abemaciclib can be decreased when combined with Sulfamethoxazole.
AbirateroneThe metabolism of Sulfamethoxazole can be decreased when combined with Abiraterone.
AcalabrutinibThe metabolism of Acalabrutinib can be decreased when combined with Sulfamethoxazole.
AcarboseThe risk or severity of hypoglycemia can be increased when Acarbose is combined with Sulfamethoxazole.
AcebutololThe therapeutic efficacy of Sulfamethoxazole can be increased when used in combination with Acebutolol.
AceclofenacThe risk or severity of hyperkalemia can be increased when Sulfamethoxazole is combined with Aceclofenac.
AcemetacinThe risk or severity of hyperkalemia can be increased when Sulfamethoxazole is combined with Acemetacin.
AcenocoumarolThe serum concentration of Acenocoumarol can be increased when it is combined with Sulfamethoxazole.
Identify potential medication risks
Easily compare up to 40 drugs with our drug interaction checker.
Get severity rating, description, and management advice.
Learn more
Food Interactions
No interactions found.


Drug product information from 10+ global regions
Our datasets provide approved product information including:
dosage, form, labeller, route of administration, and marketing period.
Access now
Access drug product information from over 10 global regions.
Access now
Product Images
International/Other Brands
Gantanol / Sinomin / Urobak
Brand Name Prescription Products
NameDosageStrengthRouteLabellerMarketing StartMarketing EndRegionImage
Sulfamethoxazole Tab 500mgTablet500 mg / tabOralPro Doc Limitee1978-12-311999-08-12Canada flag
Generic Prescription Products
NameDosageStrengthRouteLabellerMarketing StartMarketing EndRegionImage
Apo Sulfamethoxazole Tab 500mgTablet500 mgOralApotex Corporation1978-12-312018-09-14Canada flag
Sulfamethoxazole and TrimethoprimTablet800 mg/1OralRemedy Repack2012-07-162012-11-09US flag
Mixture Products
NameIngredientsDosageRouteLabellerMarketing StartMarketing EndRegionImage
Apo-sulfatrim Oral SuspensionSulfamethoxazole (40 mg / mL) + Trimethoprim (8 mg / mL)SuspensionOralApotex Corporation1989-12-31Not applicableCanada flag
BACOPRIM FORTE TABLETSSulfamethoxazole (800 MG) + Trimethoprim (160 MG)TabletOralบริษัท เอช.เค.ฟาร์มาซูติคอล จำกัด2015-11-27Not applicableThailand flag
BACOPRIM SYRUPSulfamethoxazole (200 MG/5ML) + Trimethoprim (40 MG/5ML)Suspensionบริษัท เอช.เค.ฟาร์มาซูติคอล จำกัด2015-12-04Not applicableThailand flag
BACTIGRAM F SUSPENSIÓNSulfamethoxazole (8000 mg) + Trimethoprim (1600 mg)SuspensionOralCOASPHARMA S.A.S.2006-11-102021-10-01Colombia flag
BACTIGRAM- F COMPRIMIDOSSulfamethoxazole (800 mg) + Trimethoprim (160 mg)TabletOralCOASPHARMA S.A.S2006-11-102021-10-01Colombia flag
BactrimSulfamethoxazole (400 mg/1) + Trimethoprim (80 mg/1)TabletOralAR Scientific, Inc.2004-11-012018-12-28US flag
BactrimSulfamethoxazole (400 mg/1) + Trimethoprim (80 mg/1)TabletOralSun Pharmaceutical Industries, Inc2004-11-01Not applicableUS flag
BACTRIM 200/40 MG SUSPANSIYON, 100 MLSulfamethoxazole (200 mg/5ml) + Trimethoprim (40 mg/5ml)SuspensionOralDeva Holding A.S.2020-08-14Not applicableTurkey flag
BACTRIM 400 MG/80 MG I.V. ENJEKSİYONLUK ÇÖZELTİ İÇEREN AMPUL, 1 ADETSulfamethoxazole (400 mg) + Trimethoprim (80 mg)Injection, solutionIntravenousDeva Holding A.S.2020-08-14Not applicableTurkey flag
Bactrim DSSulfamethoxazole (800 mg/1) + Trimethoprim (160 mg/1)TabletOralPhysicians Total Care, Inc.1997-08-26Not applicableUS flag
Unapproved/Other Products
NameIngredientsDosageRouteLabellerMarketing StartMarketing EndRegionImage
TRIMOKS FORT TABLET, 20 ADETSulfamethoxazole (800 mg) + Trimethoprim (160 mg)TabletOralATABAY KİMYA SAN. VE TİC. A.Ş.2020-08-14Not applicableTurkey flag
TRIMOKS PED. 100 ML SUSPANSIYONSulfamethoxazole (400 mg) + Trimethoprim (80 mg)SuspensionOralATABAY KİMYA SAN. VE TİC. A.Ş.2020-08-14Not applicableTurkey flag
TRIMOKS TABLET, 30 ADETSulfamethoxazole (400 mg) + Trimethoprim (80 mg)TabletOralATABAY KİMYA SAN. VE TİC. A.Ş.2020-08-14Not applicableTurkey flag


ATC Codes
J04AM08 — Isoniazid, sulfamethoxazole, trimethoprim and pyridoxineJ01EE01 — Sulfamethoxazole and trimethoprimG01AE10 — Combinations of sulfonamidesJ01EC01 — Sulfamethoxazole
Drug Categories
Chemical TaxonomyProvided by Classyfire
This compound belongs to the class of organic compounds known as aminobenzenesulfonamides. These are organic compounds containing a benzenesulfonamide moiety with an amine group attached to the benzene ring.
Organic compounds
Super Class
Benzene and substituted derivatives
Sub Class
Direct Parent
Alternative Parents
Benzenesulfonyl compounds / Aniline and substituted anilines / Organosulfonamides / Imidolactams / Isoxazoles / Heteroaromatic compounds / Aminosulfonyl compounds / Oxacyclic compounds / Azacyclic compounds / Primary amines
show 4 more
Amine / Aminobenzenesulfonamide / Aminosulfonyl compound / Aniline or substituted anilines / Aromatic heteromonocyclic compound / Azacycle / Azole / Benzenesulfonyl group / Heteroaromatic compound / Hydrocarbon derivative
show 16 more
Molecular Framework
Aromatic heteromonocyclic compounds
External Descriptors
substituted aniline, sulfonamide, isoxazoles, sulfonamide antibiotic (CHEBI:9332)
Affected organisms
  • Pneumocystis carinii
  • Streptococcus pyogenes
  • Streptococcus pneumoniae
  • Haemophilus influenzae
  • Neisseria gonorrhoeae
  • Vibrio cholerae
  • Escherichia coli
  • Staphylococcus aureus
  • Staphylococcus epidermidis
  • Proteus vulgaris
  • Shigella
  • Proteus mirabilis
  • Streptococcus viridans
  • Morganella morganii
  • Enterobacter aerogenes
  • Klebsiella spp.
  • Salmonella spp.
  • Brucella melitensis
  • Nocardia asteroides
  • Nocardia brasiliensis
  • Paracoccidioides brasiliensis
  • Streptomyces somaliensis

Chemical Identifiers

CAS number
InChI Key


Synthesis Reference

Yasushi Takagishi, Kiichiro Ohsuga, Sadao Ohama, "Suppository containing sulfamethoxazole/trimethoprim complex and process for preparing the same." U.S. Patent US4461765, issued December, 1975.

General References
  1. Kazanjian P, Locke AB, Hossler PA, Lane BR, Bartlett MS, Smith JW, Cannon M, Meshnick SR: Pneumocystis carinii mutations associated with sulfa and sulfone prophylaxis failures in AIDS patients. AIDS. 1998 May 28;12(8):873-8. doi: 10.1097/00002030-199808000-00009. [Article]
  2. Khalil I, Ronn AM, Alifrangis M, Gabar HA, Satti GM, Bygbjerg IC: Dihydrofolate reductase and dihydropteroate synthase genotypes associated with in vitro resistance of Plasmodium falciparum to pyrimethamine, trimethoprim, sulfadoxine, and sulfamethoxazole. Am J Trop Med Hyg. 2003 May;68(5):586-9. doi: 10.4269/ajtmh.2003.68.586. [Article]
  3. Yun MK, Wu Y, Li Z, Zhao Y, Waddell MB, Ferreira AM, Lee RE, Bashford D, White SW: Catalysis and sulfa drug resistance in dihydropteroate synthase. Science. 2012 Mar 2;335(6072):1110-4. doi: 10.1126/science.1214641. [Article]
  4. Kemnic TR, Coleman M: Trimethoprim Sulfamethoxazole . [Article]
  5. Novelli A, Rosi E: Pharmacological properties of oral antibiotics for the treatment of uncomplicated urinary tract infections. J Chemother. 2017 Dec;29(sup1):10-18. doi: 10.1080/1120009X.2017.1380357. [Article]
  6. Bushby SR: Synergy of trimethoprim-sulfamethoxazole. Can Med Assoc J. 1975 Jun 14;112(13 Spec No):63-6. [Article]
  7. Zhou SF, Zhou ZW, Yang LP, Cai JP: Substrates, inducers, inhibitors and structure-activity relationships of human Cytochrome P450 2C9 and implications in drug development. Curr Med Chem. 2009;16(27):3480-675. Epub 2009 Sep 1. [Article]
  8. van der Ven AJ, Mantel MA, Vree TB, Koopmans PP, van der Meer JW: Formation and elimination of sulphamethoxazole hydroxylamine after oral administration of sulphamethoxazole. Br J Clin Pharmacol. 1994 Aug;38(2):147-50. doi: 10.1111/j.1365-2125.1994.tb04339.x. [Article]
  9. FDA Approved Drug Products: Bactrim (sulfamethoxazole/trimethoprim) oral tablets [Link]
  10. Health Canada Product Monograph: Septra (sulfamethoxazole/trimethoprim) for intravenous injection [Link]
  11. FDA Approved Drug Products: Sulfamethoxazole/Trimethoprim oral suspension [Link]
  12. CaymanChem: Sulfamethoxazole MSDS [Link]
Human Metabolome Database
KEGG Compound
PubChem Compound
PubChem Substance
Therapeutic Targets Database
PDBe Ligand
RxList Drug Page
PDB Entries
3tzf / 6y08 / 6ysx

Clinical Trials

Clinical Trials
4CompletedEducational/Counseling/TrainingDiarrhea / Human Immunodeficiency Virus (HIV) Infections / Opportunistic Infections / Plasmodium Infections / Pneumonia1
4CompletedPreventionAcquired Immune Deficiency Syndrome (AIDS) / Anemia / Human Immunodeficiency Virus (HIV) Infections / Neutropenia / Newborn Infants1
4CompletedPreventionAllograft Rejection / Asymptomatic Bacteriuria / Hospitalizations / Microbiologic Resistance / Urinary Tract Infection1
4CompletedPreventionAntibiotic Side Effect / Human Immunodeficiency Virus Type 1 (HIV-1) Infection / Opportunistic Infections / Pneumocystis Jirovecii Pneumonia / Preventive Therapy1
4CompletedPreventionAsymptomatic Bacteriuria / Urinary Tract Infection1
4CompletedPreventionBacteriuria / Urinary Tract Infection1
4CompletedPreventionInfection Prophylaxis in Colo Rectal Surgery1
4CompletedPreventionPyelonephritis / Renal Scars1
4CompletedTreatmentAcquired Immune Deficiency Syndrome (AIDS) / Toxoplasmic Encephalitis1
4CompletedTreatmentDevelopment, Child1


  • Hoffmann la roche inc
  • Ascot hosp pharmaceuticals inc div travenol laboratories inc
  • Barr laboratories inc
  • Heather drug co inc
  • Sandoz inc
  • Watson laboratories inc
  • Shionogi usa inc
  • Medisca Inc.
Dosage Forms
TabletOral500 mg
TabletOral400 MG
TabletOral800 MG
Tablet, solubleOral800 MG
SolutionIntravenous400 mg
Injection, solutionIntravenous
Injection, solution, concentrateIntramuscular; Intravenous
SuspensionOral8 g
Tablet, film coatedOral
SuspensionOral8 mg
Capsule, coatedOral
Tablet, solubleOral
PowderNot applicable1 g/1g
Injection, solution, concentrateIntravenous
TabletOral800 mg/1
TabletOral500 mg / tab
Tablet, coatedOral800 mg
SuspensionOral4 g
TabletOral800 mg
TabletOral400 mg
Powder, for suspensionOral
Tablet, coatedOral
Tablet, sugar coatedOral
Unit descriptionCostUnit
Sulfamethoxazole-TMP DS 800-160 mg tablet0.94USD tablet
Sulfamethoxazole powder0.41USD g
DrugBank does not sell nor buy drugs. Pricing information is supplied for informational purposes only.
Not Available


Experimental Properties
melting point (°C)167 °CPhysProp
water solubility610 mg/L (at 37 °C)YALKOWSKY,SH & DANNENFELSER,RM (1992)
logP0.89HANSCH,C ET AL. (1995)
logS-2.62ADME Research, USCD
Predicted Properties
Water Solubility0.459 mg/mLALOGPS
pKa (Strongest Acidic)6.16ChemAxon
pKa (Strongest Basic)1.97ChemAxon
Physiological Charge-1ChemAxon
Hydrogen Acceptor Count4ChemAxon
Hydrogen Donor Count2ChemAxon
Polar Surface Area98.22 Å2ChemAxon
Rotatable Bond Count2ChemAxon
Refractivity64.5 m3·mol-1ChemAxon
Polarizability24.99 Å3ChemAxon
Number of Rings2ChemAxon
Rule of FiveYesChemAxon
Ghose FilterYesChemAxon
Veber's RuleNoChemAxon
MDDR-like RuleNoChemAxon
Predicted ADMET Features
Human Intestinal Absorption+1.0
Blood Brain Barrier+0.9382
Caco-2 permeable-0.5346
P-glycoprotein substrateNon-substrate0.8884
P-glycoprotein inhibitor INon-inhibitor0.9362
P-glycoprotein inhibitor IINon-inhibitor0.8754
Renal organic cation transporterNon-inhibitor0.9195
CYP450 2C9 substrateNon-substrate0.7652
CYP450 2D6 substrateNon-substrate0.9115
CYP450 3A4 substrateNon-substrate0.7632
CYP450 1A2 substrateNon-inhibitor0.9045
CYP450 2C9 inhibitorNon-inhibitor0.9071
CYP450 2D6 inhibitorNon-inhibitor0.9231
CYP450 2C19 inhibitorNon-inhibitor0.9025
CYP450 3A4 inhibitorNon-inhibitor0.9744
CYP450 inhibitory promiscuityLow CYP Inhibitory Promiscuity0.7151
Ames testNon AMES toxic0.9132
BiodegradationNot ready biodegradable0.9882
Rat acute toxicity1.6422 LD50, mol/kg Not applicable
hERG inhibition (predictor I)Weak inhibitor0.9143
hERG inhibition (predictor II)Non-inhibitor0.8956
ADMET data is predicted using admetSAR, a free tool for evaluating chemical ADMET properties. (23092397)


Mass Spec (NIST)
Download (9.61 KB)
SpectrumSpectrum TypeSplash Key
Predicted GC-MS Spectrum - GC-MSPredicted GC-MSNot Available
GC-MS Spectrum - EI-BGC-MSsplash10-05mo-8900000000-8a6ba1e89f89f5cb1e3c
Predicted MS/MS Spectrum - 10V, Positive (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 20V, Positive (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 40V, Positive (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 10V, Negative (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 20V, Negative (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 40V, Negative (Annotated)Predicted LC-MS/MSNot Available
LC-MS/MS Spectrum - LC-ESI-qTof , PositiveLC-MS/MSNot Available
LC-MS/MS Spectrum - LC-ESI-qTof , PositiveLC-MS/MSNot Available
LC-MS/MS Spectrum - LC-ESI-QTOF , negativeLC-MS/MSsplash10-0a4i-0940000000-88c5b1ef2f503737ca9a
LC-MS/MS Spectrum - LC-ESI-QTOF , negativeLC-MS/MSsplash10-0a4i-0900000000-b1b1b8e70ec8043bb89b
LC-MS/MS Spectrum - LC-ESI-QTOF , negativeLC-MS/MSsplash10-0a4i-0900000000-f9d7f50685c7e96eefcd
LC-MS/MS Spectrum - LC-ESI-ITFT , negativeLC-MS/MSsplash10-0a4i-0900000000-465bcb56920d86311f93
LC-MS/MS Spectrum - LC-ESI-ITFT , negativeLC-MS/MSsplash10-0udi-0390000000-5dac2c73d05262cd10c0
LC-MS/MS Spectrum - LC-ESI-ITFT , negativeLC-MS/MSsplash10-0a4i-0900000000-754d521e9fa8d49057e7
LC-MS/MS Spectrum - LC-ESI-ITFT , negativeLC-MS/MSsplash10-0a4i-0900000000-5dea192ddf68e39f5c6c
LC-MS/MS Spectrum - LC-ESI-ITFT , negativeLC-MS/MSsplash10-0a4i-5900000000-f376319dc72913e8db61
LC-MS/MS Spectrum - LC-ESI-ITFT , negativeLC-MS/MSsplash10-08fu-9300000000-275ed92901e4719e8eb0
LC-MS/MS Spectrum - LC-ESI-ITFT , negativeLC-MS/MSsplash10-0udi-0290000000-b02c397c2d2954785c81
LC-MS/MS Spectrum - LC-ESI-ITFT , negativeLC-MS/MSsplash10-0a4i-0900000000-c61eade368561111e908
LC-MS/MS Spectrum - LC-ESI-ITFT , negativeLC-MS/MSsplash10-0a4i-0900000000-c85d502fd299d3c8942c
LC-MS/MS Spectrum - LC-ESI-ITFT , negativeLC-MS/MSsplash10-0a4i-4900000000-c8c24b18f27b59f6e693
LC-MS/MS Spectrum - LC-ESI-ITFT , negativeLC-MS/MSsplash10-0a4i-0900000000-c61eade368561111e908
LC-MS/MS Spectrum - LC-ESI-QTOF , negativeLC-MS/MSsplash10-0a4i-0910000000-64449078c4fdd8bf4614
LC-MS/MS Spectrum - LC-ESI-QTOF , negativeLC-MS/MSsplash10-0a4i-3900000000-58869a5ce23e7feeeedf
LC-MS/MS Spectrum - LC-ESI-QTOF , negativeLC-MS/MSsplash10-03di-9000000000-c388b00730b45caa4648
LC-MS/MS Spectrum - LC-ESI-QTOF , positiveLC-MS/MSsplash10-0a4i-3910000000-a82697559a690c6121ea
LC-MS/MS Spectrum - LC-ESI-QTOF , positiveLC-MS/MSsplash10-0a4i-0910000000-44dbcbdfb3ce5df0ba57
LC-MS/MS Spectrum - LC-ESI-QTOF , positiveLC-MS/MSsplash10-0a4i-0900000000-181bb6cd1b54b2b6495c
LC-MS/MS Spectrum - LC-ESI-QTOF , positiveLC-MS/MSsplash10-052b-0900000000-ef143045595a430e870d
LC-MS/MS Spectrum - LC-ESI-QTOF , positiveLC-MS/MSsplash10-0002-0900000000-c3682226c90f2e2715a0
LC-MS/MS Spectrum - LC-ESI-QTOF , positiveLC-MS/MSsplash10-0udi-0190000000-24d764d31dded89ff00f
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-052v-0900000000-2bfa4615b96e29115a6b
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-0udi-0090000000-64a7ff77c37052fd7340
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-0pb9-2940000000-0ca0de185b8cef9d025b
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-0a4i-4900000000-7fa1e7f1e8a16439e36b
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-0a4l-7900000000-8584244d965e9da53c66
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-052f-9500000000-00c6bdb3c2f34a8492b6
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-05mo-9400000000-914135419173af598f05
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-0udi-0090000000-cf49e6fbc7d210f2db82
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-0pb9-2940000000-cf1c49b6edd74e0db359
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-0a4i-4900000000-be7ef446a6f0292a0c15
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-0a4l-7900000000-96c9b596ad5235d5e8fd
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-052f-9600000000-c5bd253f35dc1f56f173
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-05mo-9400000000-68dc3bc1422a652b6c43
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-0a4v-0900000000-e147c7f66af9a39125b4
LC-MS/MS Spectrum - LC-ESI-QTOF , positiveLC-MS/MSsplash10-0zfr-2970000000-6fea429d8717a3a0e019
LC-MS/MS Spectrum - LC-ESI-QTOF , positiveLC-MS/MSsplash10-0a4l-6900000000-b134f68352446228a2de
LC-MS/MS Spectrum - LC-ESI-QTOF , positiveLC-MS/MSsplash10-00kf-9200000000-f766fcb18caedb6dc7b8
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-0a4l-6900000000-55bf55718dd534098430
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-052f-9500000000-6adbdcc86fd0c4aac92a
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-0a4r-0900000000-e69bb2beedb2b53adcda
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-0a4r-0900000000-c7d050466aea7503baaf
MS/MS Spectrum - , positiveLC-MS/MSsplash10-0zfr-1970000000-cbfc43ff8e81c2553da0
MS/MS Spectrum - , positiveLC-MS/MSsplash10-0zfr-2960000000-9e8c6c452dea7906eac4
MS/MS Spectrum - , positiveLC-MS/MSsplash10-0a4i-4901000000-b25f2b64f82210ccef6f
LC-MS/MS Spectrum - LC-ESI-QFT , positiveLC-MS/MSsplash10-0pb9-4930000000-0673f294c7ef0fcc9fc5


Build, predict & validate machine-learning models
Use our structured and evidence-based datasets to unlock new
insights and accelerate drug research.
Learn more
Use our structured and evidence-based datasets to unlock new insights and accelerate drug research.
Learn more
Escherichia coli (strain K12)
Pharmacological action
Curator comments
Note: The above was chosen as a representative target protein in a representative bacterium, and does not encompass all proteins/bacteria affected by this agent.
General Function
Metal ion binding
Specific Function
Catalyzes the condensation of para-aminobenzoate (pABA) with 6-hydroxymethyl-7,8-dihydropterin diphosphate (DHPt-PP) to form 7,8-dihydropteroate (H2Pte), the immediate precursor of folate derivatives.
Gene Name
Uniprot ID
Uniprot Name
Dihydropteroate synthase
Molecular Weight
30614.855 Da
  1. Bushby SR: Synergy of trimethoprim-sulfamethoxazole. Can Med Assoc J. 1975 Jun 14;112(13 Spec No):63-6. [Article]


Pharmacological action
General Function
Steroid hydroxylase activity
Specific Function
Cytochromes P450 are a group of heme-thiolate monooxygenases. In liver microsomes, this enzyme is involved in an NADPH-dependent electron transport pathway. It oxidizes a variety of structurally un...
Gene Name
Uniprot ID
Uniprot Name
Cytochrome P450 2C9
Molecular Weight
55627.365 Da
  1. Cribb AE, Spielberg SP, Griffin GP: N4-hydroxylation of sulfamethoxazole by cytochrome P450 of the cytochrome P4502C subfamily and reduction of sulfamethoxazole hydroxylamine in human and rat hepatic microsomes. Drug Metab Dispos. 1995 Mar;23(3):406-14. [Article]
  2. Wen X, Wang JS, Backman JT, Laitila J, Neuvonen PJ: Trimethoprim and sulfamethoxazole are selective inhibitors of CYP2C8 and CYP2C9, respectively. Drug Metab Dispos. 2002 Jun;30(6):631-5. doi: 10.1124/dmd.30.6.631. [Article]
  3. Miners JO, Birkett DJ: Cytochrome P4502C9: an enzyme of major importance in human drug metabolism. Br J Clin Pharmacol. 1998 Jun;45(6):525-38. [Article]
  4. Kagaya H, Miura M, Niioka T, Saito M, Numakura K, Habuchi T, Satoh S: Influence of NAT2 polymorphisms on sulfamethoxazole pharmacokinetics in renal transplant recipients. Antimicrob Agents Chemother. 2012 Feb;56(2):825-9. doi: 10.1128/AAC.05037-11. Epub 2011 Nov 21. [Article]
  5. Flockhart Table of Drug Interactions [Link]
Pharmacological action
General Function
Arylamine n-acetyltransferase activity
Specific Function
Participates in the detoxification of a plethora of hydrazine and arylamine drugs. Catalyzes the N- or O-acetylation of various arylamine and heterocyclic amine substrates and is able to bioactivat...
Gene Name
Uniprot ID
Uniprot Name
Arylamine N-acetyltransferase 1
Molecular Weight
33898.445 Da
  1. Zhou SF, Zhou ZW, Yang LP, Cai JP: Substrates, inducers, inhibitors and structure-activity relationships of human Cytochrome P450 2C9 and implications in drug development. Curr Med Chem. 2009;16(27):3480-675. Epub 2009 Sep 1. [Article]
Pharmacological action
General Function
Arylamine n-acetyltransferase activity
Specific Function
Participates in the detoxification of a plethora of hydrazine and arylamine drugs. Catalyzes the N- or O-acetylation of various arylamine and heterocyclic amine substrates and is able to bioactivat...
Gene Name
Uniprot ID
Uniprot Name
Arylamine N-acetyltransferase 2
Molecular Weight
33542.235 Da
  1. Zhou SF, Zhou ZW, Yang LP, Cai JP: Substrates, inducers, inhibitors and structure-activity relationships of human Cytochrome P450 2C9 and implications in drug development. Curr Med Chem. 2009;16(27):3480-675. Epub 2009 Sep 1. [Article]
Pharmacological action
General Function
Vitamin d3 25-hydroxylase activity
Specific Function
Cytochromes P450 are a group of heme-thiolate monooxygenases. In liver microsomes, this enzyme is involved in an NADPH-dependent electron transport pathway. It performs a variety of oxidation react...
Gene Name
Uniprot ID
Uniprot Name
Cytochrome P450 3A4
Molecular Weight
57342.67 Da
  1. Lehmann DF, Newman N, Morse PD: The effect of cimetidine on the formation of sulfamethoxazole hydroxylamine in patients with human immunodeficiency virus. J Clin Pharmacol. 1998 May;38(5):463-6. [Article]
  2. Ribera E, Pou L, Fernandez-Sola A, Campos F, Lopez RM, Ocana I, Ruiz I, Pahissa A: Rifampin reduces concentrations of trimethoprim and sulfamethoxazole in serum in human immunodeficiency virus-infected patients. Antimicrob Agents Chemother. 2001 Nov;45(11):3238-41. doi: 10.1128/AAC.45.11.3238-3241.2001. [Article]
  3. Rendic S: Summary of information on human CYP enzymes: human P450 metabolism data. Drug Metab Rev. 2002 Feb-May;34(1-2):83-448. [Article]


Pharmacological action
General Function
Toxic substance binding
Specific Function
Serum albumin, the main protein of plasma, has a good binding capacity for water, Ca(2+), Na(+), K(+), fatty acids, hormones, bilirubin and drugs. Its main function is the regulation of the colloid...
Gene Name
Uniprot ID
Uniprot Name
Serum albumin
Molecular Weight
69365.94 Da
  1. Bratlid D, Bergan T: Displacement of albumin-bound antimicrobial agents by bilirubin. Pharmacology. 1976;14(5):464-72. doi: 10.1159/000136629. [Article]
  2. Angelakou A, Valsami G, Koupparis M, Macheras P: Use of 1-anilino-8-napthalenesulphonate as an ion probe for the potentiometric study of the binding of sulphonamides to bovine serum albumin and plasma. J Pharm Pharmacol. 1993 May;45(5):434-8. [Article]
  3. Health Canada Product Monograph: Septra (sulfamethoxazole/trimethoprim) for intravenous injection [Link]


Pharmacological action
General Function
Transporter activity
Specific Function
Involved in the ATP-dependent secretion of bile salts into the canaliculus of hepatocytes.
Gene Name
Uniprot ID
Uniprot Name
Bile salt export pump
Molecular Weight
146405.83 Da
  1. Pedersen JM, Matsson P, Bergstrom CA, Hoogstraate J, Noren A, LeCluyse EL, Artursson P: Early identification of clinically relevant drug interactions with the human bile salt export pump (BSEP/ABCB11). Toxicol Sci. 2013 Dec;136(2):328-43. doi: 10.1093/toxsci/kft197. Epub 2013 Sep 6. [Article]

Drug created on June 13, 2005 13:24 / Updated on September 19, 2021 19:53