

Fluorouracil is a pyrimidine analog used to treat basal cell carcinomas, and as an injection in palliative cancer treatment.

Brand Names
Actikerall, Carac, Efudex, Fluoroplex, Tolak
Generic Name
DrugBank Accession Number

A pyrimidine analog that is an antineoplastic antimetabolite. It interferes with DNA synthesis by blocking the thymidylate synthetase conversion of deoxyuridylic acid to thymidylic acid.

Small Molecule
Average: 130.0772
Monoisotopic: 130.017855555
Chemical Formula
  • 5-Fluoracil
  • 5-Fluoropyrimidine-2,4-dione
  • 5-Fluorouracil
  • 5-Fluracil
  • 5-FU
  • Fluoro Uracil
  • Fluorouracil
  • Fluorouracilo
  • Fluorouracilum
  • Fluouracil
External IDs
  • NSC-19893
  • RO 2-9757



For the topical treatment of multiple actinic or solar keratoses. In the 5% strength it is also useful in the treatment of superficial basal cell carcinomas when conventional methods are impractical, such as with multiple lesions or difficult treatment sites. Fluorouracil injection is indicated in the palliative management of some types of cancer, including colon, esophageal, gastric, rectum, breast, biliary tract, stomach, head and neck, cervical, pancreas, renal cell, and carcinoid.

Reduce drug development failure rates
Build, train, & validate machine-learning models
with evidence-based and structured datasets.
See how
Build, train, & validate predictive machine-learning models with structured datasets.
See how
Associated Conditions
Contraindications & Blackbox Warnings
Avoid life-threatening adverse drug events
Improve clinical decision support with information on contraindications & blackbox warnings, population restrictions, harmful risks, & more.
Learn more
Avoid life-threatening adverse drug events & improve clinical decision support.
Learn more

Fluorouracil is an antineoplastic anti-metabolite. Anti-metabolites masquerade as purine or pyrimidine - which become the building blocks of DNA. They prevent these substances from becoming incorporated into DNA during the "S" phase (of the cell cycle), stopping normal development and division. Fluorouracil blocks an enzyme which converts the cytosine nucleotide into the deoxy derivative. In addition, DNA synthesis is further inhibited because Fluorouracil blocks the incorporation of the thymidine nucleotide into the DNA strand.

Mechanism of action

The precise mechanism of action has not been fully determined, but the main mechanism of fluorouracil is thought to be the binding of the deoxyribonucleotide of the drug (FdUMP) and the folate cofactor, N5–10-methylenetetrahydrofolate, to thymidylate synthase (TS) to form a covalently bound ternary complex. This results in the inhibition of the formation of thymidylate from uracil, which leads to the inhibition of DNA and RNA synthesis and cell death. Fluorouracil can also be incorporated into RNA in place of uridine triphosphate (UTP), producing a fraudulent RNA and interfering with RNA processing and protein synthesis.

incorporation into and destabilization
incorporation into and destabilization
AThymidylate synthase


Volume of distribution

Not Available

Protein binding



Hepatic. The catabolic metabolism of fluorouracil results in degradation products ( e.g., CO2, urea and α-fluoro-ß-alanine) which are inactive.

Route of elimination

Seven percent to 20% of the parent drug is excreted unchanged in the urine in 6 hours; of this over 90% is excreted in the first hour. The remaining percentage of the administered dose is metabolized, primarily in the liver.


10-20 minutes


Not Available

Adverse Effects
Improve decision support & research outcomes
With structured adverse effects data, including: blackbox warnings, adverse reactions, warning & precautions, & incidence rates.
Learn more
Improve decision support & research outcomes with our structured adverse effects data.
Learn more

LD50=230mg/kg (orally in mice)

Capecitabine Action PathwayDrug action
Fluorouracil Action PathwayDrug action
Capecitabine Metabolism PathwayDrug metabolism
Fluorouracil Metabolism PathwayDrug metabolism
Pharmacogenomic Effects/ADRs
Interacting Gene/EnzymeAllele nameGenotype(s)Defining Change(s)Type(s)DescriptionDetails
Thymidylate synthaseTSER*2Not Available(CCGCGCCACTTCGCCTGCCTCCGTCCCG)2/3/4ADR Directly StudiedPatients with this genotype have increased risk of severe neutropenia or severe diarrhea with [drug; fluorouracil].Details
Dihydropyrimidine dehydrogenase [NADP(+)]---(G;G) / (A;G)C allele / G alleleADR Directly StudiedPatients with this genotype have reduced metabolism of fluorouracil and increased risk of toxicity.Details
Glutathione S-transferase P---(A;A) / (A;G)A alleleADR Directly StudiedPatients with this genotype have increased risk of toxicity with fluorouracilDetails
Dihydropyrimidine dehydrogenase [NADP(+)]---(A;A) / (A;G)A alleleADR Directly StudiedPatients with this genotype have reduced metabolism of fluorouracil and increased risk of toxicity.Details
Dihydropyrimidine dehydrogenase [NADP(+)]---(A;A) / (A;T)T > AADR Directly StudiedPatients with this genotype have reduced metabolism of fluorouracil and increased risk of toxicity.Details
Dihydropyrimidine dehydrogenase [NADP(+)]DPYD*2A(A;A) / (A;G)G > AADR Directly StudiedThe presence of this genotype in DPYD is associated with an increased risk of drug-related toxicity from fluorouracil therapy.Details
Dihydropyrimidine dehydrogenase [NADP(+)]DPYD*13(C;C) / (A;C)A > CADR Directly StudiedThe presence of this genotype in DPYD is associated with an increased risk of drug-related toxicity from fluorouracil therapy.Details
Dihydropyrimidine dehydrogenase [NADP(+)]---(A;A) / (A;T)T > AADR Directly StudiedThe presence of this genotype in DPYD is associated with an increased risk of drug-related toxicity from fluorouracil therapy.Details
Dihydropyrimidine dehydrogenase [NADP(+)]DPYD*4(G;G) / (A:G)G > AADR Directly StudiedThe presence of this genotype in DPYD may be associated with an increased risk of drug-related toxicity from fluorouracil therapy.Details
Dihydropyrimidine dehydrogenase [NADP(+)]DPYD*5(G;G) / (A;G)A > GADR Directly StudiedThe presence of this genotype in DPYD may be associated with an increased risk of drug-related toxicity from fluorouracil therapy.Details
Dihydropyrimidine dehydrogenase [NADP(+)]DPYD*6(A;A) / (A;G)G > AADR Directly StudiedThe presence of this genotype in DPYD may be associated with an increased risk of drug-related toxicity from fluorouracil therapy.Details
Dihydropyrimidine dehydrogenase [NADP(+)]DPYD*9A(C;C) / (C;T)T > CADR Directly StudiedThe presence of this genotype in DPYD may be associated with an increased risk of drug-related toxicity from fluorouracil therapy.Details


Drug Interactions
This information should not be interpreted without the help of a healthcare provider. If you believe you are experiencing an interaction, contact a healthcare provider immediately. The absence of an interaction does not necessarily mean no interactions exist.
AbametapirThe serum concentration of Fluorouracil can be increased when it is combined with Abametapir.
AbataceptThe metabolism of Fluorouracil can be increased when combined with Abatacept.
AbciximabThe risk or severity of bleeding can be increased when Abciximab is combined with Fluorouracil.
AbemaciclibAbemaciclib may decrease the excretion rate of Fluorouracil which could result in a higher serum level.
AbirateroneThe serum concentration of Fluorouracil can be increased when it is combined with Abiraterone.
AbrocitinibThe metabolism of Abrocitinib can be decreased when combined with Fluorouracil.
AcenocoumarolThe metabolism of Acenocoumarol can be decreased when combined with Fluorouracil.
AcetaminophenThe metabolism of Fluorouracil can be decreased when combined with Acetaminophen.
AcetohexamideThe metabolism of Acetohexamide can be decreased when combined with Fluorouracil.
AcetyldigitoxinAcetyldigitoxin may decrease the cardiotoxic activities of Fluorouracil.
Identify potential medication risks
Easily compare up to 40 drugs with our drug interaction checker.
Get severity rating, description, and management advice.
Learn more
Food Interactions
No interactions found.


Drug product information from 10+ global regions
Our datasets provide approved product information including:
dosage, form, labeller, route of administration, and marketing period.
Access now
Access drug product information from over 10 global regions.
Access now
Product Ingredients
IngredientUNIICASInChI Key
Fluorouracil sodiumPM476L7O8G14787-18-9XLBUSGPKSVRQSF-UHFFFAOYSA-M
International/Other Brands
Carzonal (Tobishi) / Efudix (Meda) / Efurix (Valeant) / Ftoruracil (Verofarm)
Brand Name Prescription Products
NameDosageStrengthRouteLabellerMarketing StartMarketing EndRegionImage
AdrucilSolution50 mg / mLIntravenousPfizer Canada Ulc1995-12-312004-04-08Canada flag
Adrucil Inj 50mg/mlLiquid500 mg / 10 mLIntravenousAdria Laboratories Of Canada Ltd.1978-12-311996-09-10Canada flag
CaracCream5 mg/1gTopicalBausch Health US, LLC2013-06-28Not applicableUS flag
CaracCream5 mg/1gTopicalDermik Laboratories2000-10-272015-11-30US flag
EfudexSolution1.25 g/10mLTopicalBausch Health US, LLC1970-07-292010-01-31US flag
EfudexCream5 % w/wTopicalBausch Health, Canada Inc.1975-12-31Not applicableCanada flag
EfudexSolution0.5 g/10mLTopicalBausch Health US, LLC1970-07-292008-02-28US flag
EfudexCream2 g/40gTopicalPhysicians Total Care, Inc.1970-07-292011-09-30US flag
EfudexCream2 g/40gTopicalBausch Health US, LLC1970-07-29Not applicableUS flag
FluoroplexCream10 mg/1gTopicalAllergan1993-12-032013-05-01US flag
Generic Prescription Products
NameDosageStrengthRouteLabellerMarketing StartMarketing EndRegionImage
AdrucilInjection, solution5 g/100mLIntravenousTeva Parenteral Medicines, Inc.2003-10-012020-10-31US flag
AdrucilInjection, solution2.5 g/50mLIntravenousTeva Parenteral Medicines, Inc.2003-10-012020-10-31US flag
AdrucilInjection, solution50 mg/1mLIntravenousTeva Parenteral Medicines, Inc.2003-10-012020-10-31US flag
FluorouracilCream50 mg/1gTopicalTaro Pharmaceutical Industries, Ltd.2010-03-05Not applicableUS flag
FluorouracilSolution20 mg/1mLTopicalSolubiomix2003-11-052017-10-10US flag
FluorouracilCream5 mg/1gTopicalMylan Pharmaceuticals Inc.2013-09-19Not applicableUS flag
FluorouracilCream50 mg/1gTopicalA-S Medication Solutions2010-03-05Not applicableUS flag
FluorouracilInjection, solution50 mg/1mLIntravenousSandoz Inc.2008-09-102014-10-07US flag
FluorouracilInjection, solution50 mg/1mLIntravenousPfizer Laboratories Div Pfizer Inc.2012-07-182014-11-30US flag
FluorouracilSolution20 mg/1mLTopicalTaro Pharmaceuticals U.S.A., Inc.2003-11-05Not applicableUS flag
Mixture Products
NameIngredientsDosageRouteLabellerMarketing StartMarketing EndRegionImage
ActikerallFluorouracil (0.5 % w/w) + Salicylic acid (10 % w/w)SolutionTopicalCipher Pharmaceuticals Inc.2016-02-19Not applicableCanada flag
VERRUMAL SOLUTIONFluorouracil (0.5 g/100g) + Dimethyl sulfoxide (8 g/100g) + Salicylic acid (10 g/100g)SolutionTopicalZUELLIG PHARMA PTE. LTD.1990-04-30Not applicable
VERRUTOL %0,5 + %10 DERİ ÇÖZELTİSİ (15 G)Fluorouracil (0.5 %) + Salicylic acid (10 %)SolutionTopicalORVA İLAÇ SAN. VE TİC. A.Ş.2020-08-14Not applicableTurkey flag
เวอร์รูมาลFluorouracil (0.5 %) + Dimethyl sulfoxide (8 %) + Salicylic acid (10 %)SolutionTopicalบริษัท ซิลลิค ฟาร์มา จำกัด2017-03-14Not applicableThailand flag
Unapproved/Other Products
NameIngredientsDosageRouteLabellerMarketing StartMarketing EndRegionImage
FluoracFluorouracil (5 g/100g) + Diclofenac sodium (1 g/100g)CreamTopicalBurke Therapeutics, LLC2015-01-222015-09-14US flag
VerrunexFluorouracil (0.5 g/0.5g) + Salicylic acid (1.2 g/1.2g)KitTopicalAccumix Pharmaceuticals2014-12-152015-07-17US flag


ATC Codes
L01BC52 — Fluorouracil, combinationsL01BC02 — Fluorouracil
Drug Categories
Chemical TaxonomyProvided by Classyfire
This compound belongs to the class of organic compounds known as halopyrimidines. These are aromatic compounds containing a halogen atom linked to a pyrimidine ring. Pyrimidine is a 6-membered ring consisting of four carbon atoms and two nitrogen centers at the 1- and 3- ring positions.
Organic compounds
Super Class
Organoheterocyclic compounds
Sub Class
Pyrimidines and pyrimidine derivatives
Direct Parent
Alternative Parents
Hydroxypyrimidines / Aryl fluorides / Heteroaromatic compounds / Azacyclic compounds / Organopnictogen compounds / Organooxygen compounds / Organonitrogen compounds / Organofluorides / Hydrocarbon derivatives
Aromatic heteromonocyclic compound / Aryl fluoride / Aryl halide / Azacycle / Halopyrimidine / Heteroaromatic compound / Hydrocarbon derivative / Hydroxypyrimidine / Organic nitrogen compound / Organic oxygen compound
Molecular Framework
Aromatic heteromonocyclic compounds
External Descriptors
organofluorine compound, nucleobase analogue (CHEBI:46345) / a uracil analogue (CPD0-1327)
Affected organisms
  • Humans and other mammals

Chemical Identifiers

CAS number
InChI Key


Synthesis Reference

Leroy B. Townsend, Robert A. Earl, Steven J. Manning, "Method of synthesizing 1-(tetrahydro-2-furanyl)-5-fluorouracil." U.S. Patent US3960864, issued October, 1969.

General References
  1. Longley DB, Harkin DP, Johnston PG: 5-fluorouracil: mechanisms of action and clinical strategies. Nat Rev Cancer. 2003 May;3(5):330-8. [Article]
  2. Petty RD, Cassidy J: Novel fluoropyrimidines: improving the efficacy and tolerability of cytotoxic therapy. Curr Cancer Drug Targets. 2004 Mar;4(2):191-204. [Article]
Human Metabolome Database
KEGG Compound
PubChem Compound
PubChem Substance
Therapeutic Targets Database
PDBe Ligand
RxList Drug Page Drug Page
PDB Entries
1h7x / 1rxc / 1upf / 3kvr / 3kvv / 3nai / 3nbq / 4e1v / 4o0o / 4txn
show 10 more
FDA label
Download (378 KB)
Download (74 KB)

Clinical Trials

Clinical Trials
4Active Not RecruitingHealth Services ResearchOpen Angle Glaucoma (OAG)1
4Active Not RecruitingTreatmentMalignant Neoplasm of Stomach / Stage IV Colorectal Cancer1
4CompletedNot AvailableEsophageal Cancer1
4CompletedPreventionBasal Cell Carcinoma (BCC) / Carcinoma / Neoplasms, Basal Cell / Neoplasms, Squamous Cell / Skin Diseases / Skin Neoplasms / Squamous Cell Carcinoma (SCC)1
4CompletedTreatmentActinic Keratosis (AK)2
4CompletedTreatmentColorectal Cancer2
4CompletedTreatmentGlaucoma / Promotion of wound healing / Trabeculectomy1
4CompletedTreatmentKeloids Scars1
4CompletedTreatmentMetastatic Colorectal Cancer (CRC)1


  • Sanofi aventis us llc
  • Valeant pharmaceuticals international
  • Allergan herbert skin care div allergan inc
  • Spear pharmaceuticals inc
  • Taro pharmaceutical industries ltd
  • Pharmacia and upjohn co
  • Teva parenteral medicines inc
  • Abic ltd
  • Abraxis pharmaceutical products
  • App pharmaceuticals llc
  • Bedford laboratories div ben venue laboratories inc
  • Bioniche pharma usa llc
  • Ebewe pharma ges mbh nfg kg
  • Marchar laboratories inc ltd
  • Smith and nephew solopak div smith and nephew
  • Watson laboratories inc
  • Elorac inc
  • Taro pharmaceuticals usa inc
  • Allergan Inc.
  • Amcol Health and Beauty Solutions
  • APP Pharmaceuticals
  • APPD
  • Baxter International Inc.
  • Bigmar Bioren Pharmaceuticals Sa
  • Contract Pharm
  • Creative Cosmetics Inc.
  • Dermik Labs
  • Dispensing Solutions
  • Ebewe Pharma
  • Generamedix Inc.
  • Hospira Inc.
  • Intas Pharmaceuticals Ltd.
  • Legacy Pharmaceuticals Packaging LLC
  • Medisca Inc.
  • Oceanside Pharmaceuticals Incorporated
  • Pharmacia Inc.
  • Physicians Total Care Inc.
  • Sanofi-Aventis Inc.
  • Sicor Pharmaceuticals
  • Solco Healthcare US LLC
  • Spear Dermatology Products Inc.
  • Synerx Pharma LLC
  • Taro Pharmaceuticals USA
  • Teva Pharmaceutical Industries Ltd.
  • Valeant Ltd.
Dosage Forms
InjectionParenteral10000 mg
Injection, solutionParenteral5000 mg
InjectionParenteral500 mg
OintmentTopical5 g
Injection, solution, concentrateIntravenous
SolutionParenteral1000 mg
LiquidIntravenous500 mg / 10 mL
CreamTopical5 mg/1g
InjectionIntravenous25 mg
Injection, solutionIntra-arterial; Intravenous
CreamTopical2 g/40g
CreamTopical5 % w/w
SolutionTopical0.5 g/10mL
SolutionTopical1.25 g/10mL
Injection, solutionIntravenous50 MG/ML
CreamTopical5 g
Injection, solutionIntravenous
CreamTopical10 mg/1g
CreamTopical1 %
CreamTopical50 mg/1g
Injection50 mg/10ml
InjectionIntravenous2.5 g/50mL
Injection, solutionIntravenous2.5 g/50mL
Injection, solutionIntravenous5 g/100mL
Injection, solutionIntravenous50 mg/1mL
SolutionTopical20 mg/1mL
SolutionTopical50 mg/1mL
InjectionIntra-arterial; Intravenous50 MG/ML
InjectionParenteral5000 MG/100ML
InjectionParenteral1000 MG/20ML
InjectionParenteral500 MG/10ML
Injection, solutionParenteral
LiquidIntravenous50 mg / mL
Injection, solution50 mg/1ml
SolutionIntravenous0.5 g / 10 mL
SolutionIntravenous1000 mg / 20 mL
SolutionIntravenous250 mg / 5 mL
SolutionIntravenous5 g / 100 mL
SolutionIntravenous50 mg / mL
SolutionIntravenous500 mg / 10 mL
SolutionIntravenous5000 mg / 100 mL
InjectionIntravenous50 mg/ml
Injection, solutionIntra-arterial; Intravenous50 mg/ml
InjectionIntravenous25 mg/ml
SolutionIntravenous50 mg/1ml
Injection, solutionParenteral1000 MG
Injection, solutionIntravenous; Parenteral
Injection, solution
Injection, solutionParenteral50 MG/ML
Injection, solutionIntra-arterial
Injection, solutionIntravenous500 mg/10ml
Injection, solutionIntravenous; Parenteral250 MG/ML
Injection, solutionIntravenous; Parenteral500 MG/10ML
Injection, solutionParenteral1 G/20ML
Injection, solutionParenteral250 MG/5ML
Injection, solutionParenteral5 G/100ML
Injection, solutionParenteral500 MG/10ML
SolutionIntravenous250 mg
SolutionParenteral50 mg
SolutionParenteral25 mg
SolutionIntravenous500 mg
SolutionParenteral500 mg
Tablet, film coatedOral500 mg
SolutionIntravenous50 mg
CreamTopical0.04 g/1g
CreamTopical4 % w/w
CreamTopical40 mg/1g
SolutionTopical8 g/100g
Solution50 mg/1ml
Unit descriptionCostUnit
Efudex 5% Cream 40 gm Tube478.39USD tube
Fluoroplex 1% Cream 30 gm Tube268.61USD tube
Fluorouracil 5% Cream 40 gm Tube249.98USD tube
Carac 0.5% Cream 30 gm Tube209.77USD tube
Efudex 5% Solution 10ml Bottle136.51USD bottle
Fluorouracil 5% Solution 10ml Bottle115.78USD bottle
Fluorouracil 2% Solution 10ml Bottle78.63USD bottle
Efudex 5% cream10.28USD g
Fluorouracil 5% cream9.62USD g
Fluorouracil powder8.45USD g
Fluoroplex 1% cream7.85USD g
Carac cream6.43USD g
Efudex 50 mg/g Cream0.9USD g
Fluorouracil 50 mg/ml Solution0.52USD ml
Adrucil 50 mg/ml vial0.4USD ml
Fluorouracil 5000 mg/100 ml0.28USD ml
DrugBank does not sell nor buy drugs. Pricing information is supplied for informational purposes only.
Patent NumberPediatric ExtensionApprovedExpires (estimated)Region
US6670335No2003-12-302021-06-02US flag
US7169401No2007-01-302023-07-18US flag


Experimental Properties
melting point (°C)282-283Heidelberger, C. and Duschinsky, R.; US. Patent 2,802,005; August 6, 1957. Heidelberger, C. and Duschinsky, R.; U.S.Patent 2,885,396; May 5, 1959.
water solubility1.11E+004 mg/L (at 22 °C)BURR,A & BUNDGAARD,H (1985)
logP-0.89HANSCH,C ET AL. (1995)
logS-1.07ADME Research, USCD
pKa8.02SANGSTER (1994)
Predicted Properties
Water Solubility5.86 mg/mLALOGPS
pKa (Strongest Acidic)7.18ChemAxon
pKa (Strongest Basic)-8ChemAxon
Physiological Charge-1ChemAxon
Hydrogen Acceptor Count2ChemAxon
Hydrogen Donor Count2ChemAxon
Polar Surface Area58.2 Å2ChemAxon
Rotatable Bond Count0ChemAxon
Refractivity26.17 m3·mol-1ChemAxon
Polarizability9.46 Å3ChemAxon
Number of Rings1ChemAxon
Rule of FiveYesChemAxon
Ghose FilterNoChemAxon
Veber's RuleNoChemAxon
MDDR-like RuleNoChemAxon
Predicted ADMET Features
Human Intestinal Absorption+0.9605
Blood Brain Barrier+0.9791
Caco-2 permeable-0.7583
P-glycoprotein substrateNon-substrate0.7752
P-glycoprotein inhibitor INon-inhibitor0.8991
P-glycoprotein inhibitor IINon-inhibitor1.0
Renal organic cation transporterNon-inhibitor0.9053
CYP450 2C9 substrateNon-substrate0.7898
CYP450 2D6 substrateNon-substrate0.9116
CYP450 3A4 substrateNon-substrate0.7558
CYP450 1A2 substrateNon-inhibitor0.9045
CYP450 2C9 inhibitorNon-inhibitor0.9658
CYP450 2D6 inhibitorNon-inhibitor0.9361
CYP450 2C19 inhibitorNon-inhibitor0.9688
CYP450 3A4 inhibitorNon-inhibitor0.9661
CYP450 inhibitory promiscuityLow CYP Inhibitory Promiscuity0.9839
Ames testNon AMES toxic0.8941
BiodegradationNot ready biodegradable0.922
Rat acute toxicity2.2529 LD50, mol/kg Not applicable
hERG inhibition (predictor I)Weak inhibitor0.9685
hERG inhibition (predictor II)Non-inhibitor0.9325
ADMET data is predicted using admetSAR, a free tool for evaluating chemical ADMET properties. (23092397)


Mass Spec (NIST)
Download (7.93 KB)
SpectrumSpectrum TypeSplash Key
Predicted GC-MS Spectrum - GC-MSPredicted GC-MSNot Available
GC-MS Spectrum - EI-BGC-MSsplash10-001i-9800000000-a3301f9fea9145d07480
GC-MS Spectrum - CI-BGC-MSsplash10-001i-0900000000-76691bd3cba2765d3687
GC-MS Spectrum - CI-BGC-MSsplash10-001i-0900000000-d801d8209e9a5aa4830b
GC-MS Spectrum - CI-BGC-MSsplash10-0002-0900000000-7521695ae4a96b4a5a98
Mass Spectrum (Electron Ionization)MSsplash10-001i-9400000000-b8247c8f5c45b12efaa6
Predicted MS/MS Spectrum - 10V, Positive (Annotated)Predicted LC-MS/MSsplash10-001i-1900000000-3fa9b91447db7dc7ba77
Predicted MS/MS Spectrum - 20V, Positive (Annotated)Predicted LC-MS/MSsplash10-01q9-9800000000-32bf878787078ce9d817
Predicted MS/MS Spectrum - 40V, Positive (Annotated)Predicted LC-MS/MSsplash10-03di-9000000000-3ef559051a5b99c94b29
Predicted MS/MS Spectrum - 10V, Negative (Annotated)Predicted LC-MS/MSsplash10-004i-4900000000-82764fbca3290816328d
Predicted MS/MS Spectrum - 20V, Negative (Annotated)Predicted LC-MS/MSsplash10-000f-9100000000-2da5eb3c925c027b5022
Predicted MS/MS Spectrum - 40V, Negative (Annotated)Predicted LC-MS/MSsplash10-0006-9000000000-1cf432837297c55833a5
LC-MS/MS Spectrum - LC-ESI-ITFT , negativeLC-MS/MSsplash10-004i-0900000000-c639ed1b5365f368b59c
LC-MS/MS Spectrum - LC-ESI-ITFT , negativeLC-MS/MSsplash10-004i-0900000000-1a7a70df49a360e1458c
LC-MS/MS Spectrum - LC-ESI-ITFT , negativeLC-MS/MSsplash10-004i-0900000000-d89f2d944fe1cac39f55
LC-MS/MS Spectrum - LC-ESI-ITFT , negativeLC-MS/MSsplash10-004i-0900000000-50b33770c08680863cf6
LC-MS/MS Spectrum - LC-ESI-ITFT , negativeLC-MS/MSsplash10-004i-0900000000-cd5bef421a05073cb1f3
LC-MS/MS Spectrum - LC-ESI-ITFT , negativeLC-MS/MSsplash10-004i-3900000000-ec9c9e1dfc9a16f625a2
LC-MS/MS Spectrum - LC-ESI-ITFT , negativeLC-MS/MSsplash10-004i-0900000000-df98a4532ca49a0a0436
LC-MS/MS Spectrum - LC-ESI-ITFT , negativeLC-MS/MSsplash10-004i-0900000000-50b33770c08680863cf6
LC-MS/MS Spectrum - LC-ESI-ITFT , negativeLC-MS/MSsplash10-004i-0900000000-50b33770c08680863cf6
LC-MS/MS Spectrum - LC-ESI-ITFT , negativeLC-MS/MSsplash10-004i-0900000000-df98a4532ca49a0a0436
LC-MS/MS Spectrum - LC-ESI-ITFT , negativeLC-MS/MSsplash10-004i-0900000000-b117f5fa58c8f98b5c15
LC-MS/MS Spectrum - LC-ESI-ITFT , negativeLC-MS/MSsplash10-0a4i-9000000000-f3e71a41b6d4417d33fd
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-001i-9200000000-29362607b7c48b82973c
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-001i-0900000000-693d492f316b0c7d5ed5
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-001i-1900000000-0c0ee9469bf49688c5d2
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-001i-1900000000-0cecca0d265e958e19d7
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-03e9-1900000000-46f20f71dbc96630cee7
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-03di-1900000000-4330f38956afe6c47636
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-03di-2900000000-f935071622b89177697b
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-001i-1900000000-0c8117152496e5ab5079
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-001i-2900000000-266589a25e715aef690b
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-001i-2900000000-7e7fde9573014635482d
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-01q9-3900000000-50eaff02ec3eceb8cb1c
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-03di-2900000000-09de643cc91751ca7a60
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-03di-4900000000-7904c5572d0bc60f8d35
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-001i-9000000000-a0c3963f64cbd8167800
1H NMR Spectrum1D NMRNot Applicable


Build, predict & validate machine-learning models
Use our structured and evidence-based datasets to unlock new
insights and accelerate drug research.
Learn more
Use our structured and evidence-based datasets to unlock new insights and accelerate drug research.
Learn more
Pharmacological action
Incorporation into and destabilization
DNA is the molecule of heredity, as it is responsible for the genetic propagation of most inherited traits. It is a polynucleic acid that carries genetic information on cell growth, division, and function. DNA consists of two long strands of nucleotides twisted into a double helix and held together by hydrogen bonds. The sequence of nucleotides determines hereditary characteristics. Each strand serves as the template for subsequent DNA replication and as a template for mRNA production, leading to protein synthesis via ribosomes.
  1. Wyatt MD, Wilson DM 3rd: Participation of DNA repair in the response to 5-fluorouracil. Cell Mol Life Sci. 2009 Mar;66(5):788-99. doi: 10.1007/s00018-008-8557-5. [Article]
  2. Ghoshal K, Jacob ST: An alternative molecular mechanism of action of 5-fluorouracil, a potent anticancer drug. Biochem Pharmacol. 1997 Jun 1;53(11):1569-75. [Article]
  3. Longley DB, Harkin DP, Johnston PG: 5-fluorouracil: mechanisms of action and clinical strategies. Nat Rev Cancer. 2003 May;3(5):330-8. [Article]
  4. Petty RD, Cassidy J: Novel fluoropyrimidines: improving the efficacy and tolerability of cytotoxic therapy. Curr Cancer Drug Targets. 2004 Mar;4(2):191-204. [Article]
  5. Singh V, Brecik M, Mukherjee R, Evans JC, Svetlikova Z, Blasko J, Surade S, Blackburn J, Warner DF, Mikusova K, Mizrahi V: The complex mechanism of antimycobacterial action of 5-fluorouracil. Chem Biol. 2015 Jan 22;22(1):63-75. doi: 10.1016/j.chembiol.2014.11.006. Epub 2014 Dec 24. [Article]
Pharmacological action
Incorporation into and destabilization
  1. Wyatt MD, Wilson DM 3rd: Participation of DNA repair in the response to 5-fluorouracil. Cell Mol Life Sci. 2009 Mar;66(5):788-99. doi: 10.1007/s00018-008-8557-5. [Article]
  2. Ghoshal K, Jacob ST: An alternative molecular mechanism of action of 5-fluorouracil, a potent anticancer drug. Biochem Pharmacol. 1997 Jun 1;53(11):1569-75. [Article]
  3. Longley DB, Harkin DP, Johnston PG: 5-fluorouracil: mechanisms of action and clinical strategies. Nat Rev Cancer. 2003 May;3(5):330-8. [Article]
  4. Petty RD, Cassidy J: Novel fluoropyrimidines: improving the efficacy and tolerability of cytotoxic therapy. Curr Cancer Drug Targets. 2004 Mar;4(2):191-204. [Article]
  5. Singh V, Brecik M, Mukherjee R, Evans JC, Svetlikova Z, Blasko J, Surade S, Blackburn J, Warner DF, Mikusova K, Mizrahi V: The complex mechanism of antimycobacterial action of 5-fluorouracil. Chem Biol. 2015 Jan 22;22(1):63-75. doi: 10.1016/j.chembiol.2014.11.006. Epub 2014 Dec 24. [Article]
Pharmacological action
General Function
Thymidylate synthase activity
Specific Function
Contributes to the de novo mitochondrial thymidylate biosynthesis pathway.
Gene Name
Uniprot ID
Uniprot Name
Thymidylate synthase
Molecular Weight
35715.65 Da
  1. Formentini A, Sander S, Denzer S, Straeter J, Henne-Bruns D, Kornmann M: Thymidylate synthase expression in resectable and unresectable pancreatic cancer: role as predictive or prognostic marker? Int J Colorectal Dis. 2007 Jan;22(1):49-55. Epub 2006 Mar 15. [Article]
  2. Huang CL, Yokomise H, Fukushima M, Kinoshita M: Tailor-made chemotherapy for non-small cell lung cancer patients. Future Oncol. 2006 Apr;2(2):289-99. [Article]
  3. Fernandez-Contreras ME, Sanchez-Prudencio S, Sanchez-Hernandez JJ, Garcia de Paredes ML, Gisbert JP, Roda-Navarro P, Gamallo C: Thymidylate synthase expression pattern, expression level and single nucleotide polymorphism are predictors for disease-free survival in patients of colorectal cancer treated with 5-fluorouracil. Int J Oncol. 2006 May;28(5):1303-10. [Article]
  4. Garcia V, Garcia JM, Pena C, Silva J, Dominguez G, Hurtado A, Alonso I, Rodriguez R, Provencio M, Bonilla F: Thymidylate synthase messenger RNA expression in plasma from patients with colon cancer: prognostic potential. Clin Cancer Res. 2006 Apr 1;12(7 Pt 1):2095-100. [Article]
  5. Ploylearmsaeng SA, Fuhr U, Jetter A: How may anticancer chemotherapy with fluorouracil be individualised? Clin Pharmacokinet. 2006;45(6):567-92. [Article]
  6. Chen X, Ji ZL, Chen YZ: TTD: Therapeutic Target Database. Nucleic Acids Res. 2002 Jan 1;30(1):412-5. [Article]
  7. Rustum YM: Thymidylate synthase: a critical target in cancer therapy? Front Biosci. 2004 Sep 1;9:2467-73. [Article]
  8. Singh V, Brecik M, Mukherjee R, Evans JC, Svetlikova Z, Blasko J, Surade S, Blackburn J, Warner DF, Mikusova K, Mizrahi V: The complex mechanism of antimycobacterial action of 5-fluorouracil. Chem Biol. 2015 Jan 22;22(1):63-75. doi: 10.1016/j.chembiol.2014.11.006. Epub 2014 Dec 24. [Article]


Pharmacological action
General Function
Protein homodimerization activity
Specific Function
Involved in pyrimidine base degradation. Catalyzes the reduction of uracil and thymine. Also involved the degradation of the chemotherapeutic drug 5-fluorouracil.
Gene Name
Uniprot ID
Uniprot Name
Dihydropyrimidine dehydrogenase [NADP(+)]
Molecular Weight
111400.32 Da
  1. Ho DH, Townsend L, Luna MA, Bodey GP: Distribution and inhibition of dihydrouracil dehydrogenase activities in human tissues using 5-fluorouracil as a substrate. Anticancer Res. 1986 Jul-Aug;6(4):781-4. [Article]
  2. Keizer HJ, De Bruijn EA, Tjaden UR, De Clercq E: Inhibition of fluorouracil catabolism in cancer patients by the antiviral agent (E)-5-(2-bromovinyl)-2'-deoxyuridine. J Cancer Res Clin Oncol. 1994;120(9):545-9. [Article]
Pharmacological action
General Function
Uridine phosphorylase activity
Specific Function
Catalyzes the reversible phosphorylytic cleavage of uridine and deoxyuridine to uracil and ribose- or deoxyribose-1-phosphate (PubMed:7488099). The produced molecules are then utilized as carbon an...
Gene Name
Uniprot ID
Uniprot Name
Uridine phosphorylase 1
Molecular Weight
33934.005 Da
  1. Yan R, Wan L, Pizzorno G, Cao D: Uridine phosphorylase in breast cancer: a new prognostic factor? Front Biosci. 2006 Sep 1;11:2759-66. [Article]
Pharmacological action
General Function
Uridine phosphorylase activity
Specific Function
Catalyzes the reversible phosphorylytic cleavage of uridine and deoxyuridine to uracil and ribose- or deoxyribose-1-phosphate. The produced molecules are then utilized as carbon and energy sources ...
Gene Name
Uniprot ID
Uniprot Name
Uridine phosphorylase 2
Molecular Weight
35526.93 Da
  1. Yan R, Wan L, Pizzorno G, Cao D: Uridine phosphorylase in breast cancer: a new prognostic factor? Front Biosci. 2006 Sep 1;11:2759-66. [Article]
Pharmacological action
General Function
Steroid hydroxylase activity
Specific Function
Exhibits a high coumarin 7-hydroxylase activity. Can act in the hydroxylation of the anti-cancer drugs cyclophosphamide and ifosphamide. Competent in the metabolic activation of aflatoxin B1. Const...
Gene Name
Uniprot ID
Uniprot Name
Cytochrome P450 2A6
Molecular Weight
56501.005 Da
  1. Yamamiya I, Yoshisue K, Ishii Y, Yamada H, Yoshida K: Enantioselectivity in the cytochrome P450-dependent conversion of tegafur to 5-fluorouracil in human liver microsomes. Pharmacol Res Perspect. 2013 Oct;1(1):e00009. doi: 10.1002/prp2.9. Epub 2013 Oct 23. [Article]
Pharmacological action
General Function
Steroid hydroxylase activity
Specific Function
Cytochromes P450 are a group of heme-thiolate monooxygenases. In liver microsomes, this enzyme is involved in an NADPH-dependent electron transport pathway. It oxidizes a variety of structurally un...
Gene Name
Uniprot ID
Uniprot Name
Cytochrome P450 2C8
Molecular Weight
55824.275 Da
  1. Komatsu T, Yamazaki H, Shimada N, Nakajima M, Yokoi T: Roles of cytochromes P450 1A2, 2A6, and 2C8 in 5-fluorouracil formation from tegafur, an anticancer prodrug, in human liver microsomes. Drug Metab Dispos. 2000 Dec;28(12):1457-63. [Article]
Pharmacological action
General Function
Protein complex binding
Specific Function
Catalyzes the conversion of 5,10-methylenetetrahydrofolate to 5-methyltetrahydrofolate, a co-substrate for homocysteine remethylation to methionine.
Gene Name
Uniprot ID
Uniprot Name
Methylenetetrahydrofolate reductase
Molecular Weight
74595.895 Da
  1. Scartozzi M, Maccaroni E, Giampieri R, Pistelli M, Bittoni A, Del Prete M, Berardi R, Cascinu S: 5-Fluorouracil pharmacogenomics: still rocking after all these years? Pharmacogenomics. 2011 Feb;12(2):251-65. doi: 10.2217/pgs.10.167. [Article]
Pharmacological action
General Function
Thymidylate synthase activity
Specific Function
Contributes to the de novo mitochondrial thymidylate biosynthesis pathway.
Gene Name
Uniprot ID
Uniprot Name
Thymidylate synthase
Molecular Weight
35715.65 Da
  1. Scartozzi M, Maccaroni E, Giampieri R, Pistelli M, Bittoni A, Del Prete M, Berardi R, Cascinu S: 5-Fluorouracil pharmacogenomics: still rocking after all these years? Pharmacogenomics. 2011 Feb;12(2):251-65. doi: 10.2217/pgs.10.167. [Article]
Pharmacological action
General Function
Orotidine-5'-phosphate decarboxylase activity
Specific Function
Not Available
Gene Name
Uniprot ID
Uniprot Name
Uridine 5'-monophosphate synthase
Molecular Weight
52221.075 Da
  1. Link [Link]
Pharmacological action
General Function
Metal ion binding
Specific Function
Not Available
Gene Name
Uniprot ID
Uniprot Name
Molecular Weight
57398.52 Da
  1. Link [Link]
Pharmacological action
Curator comments
Data is limited to a in vitro study.
General Function
Oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen
Specific Function
Cytochromes P450 are a group of heme-thiolate monooxygenases. In liver microsomes, this enzyme is involved in an NADPH-dependent electron transport pathway. It oxidizes a variety of structurally un...
Gene Name
Uniprot ID
Uniprot Name
Cytochrome P450 1A2
Molecular Weight
58293.76 Da
  1. Komatsu T, Yamazaki H, Shimada N, Nakajima M, Yokoi T: Roles of cytochromes P450 1A2, 2A6, and 2C8 in 5-fluorouracil formation from tegafur, an anticancer prodrug, in human liver microsomes. Drug Metab Dispos. 2000 Dec;28(12):1457-63. [Article]
  2. Yamazaki H, Komatsu T, Takemoto K, Shimada N, Nakajima M, Yokoi T: Rat cytochrome p450 1A and 3A enzymes involved in bioactivation of tegafur to 5-fluorouracil and autoinduced by tegafur in liver microsomes. Drug Metab Dispos. 2001 Jun;29(6):794-7. [Article]
Pharmacological action
General Function
Transferase activity, transferring pentosyl groups
Specific Function
May have a role in maintaining the integrity of the blood vessels. Has growth promoting activity on endothelial cells, angiogenic activity in vivo and chemotactic activity on endothelial cells in v...
Gene Name
Uniprot ID
Uniprot Name
Thymidine phosphorylase
Molecular Weight
49954.965 Da
  1. Scartozzi M, Maccaroni E, Giampieri R, Pistelli M, Bittoni A, Del Prete M, Berardi R, Cascinu S: 5-Fluorouracil pharmacogenomics: still rocking after all these years? Pharmacogenomics. 2011 Feb;12(2):251-65. doi: 10.2217/pgs.10.167. [Article]
Pharmacological action
General Function
Steroid hydroxylase activity
Specific Function
Cytochromes P450 are a group of heme-thiolate monooxygenases. In liver microsomes, this enzyme is involved in an NADPH-dependent electron transport pathway. It oxidizes a variety of structurally un...
Gene Name
Uniprot ID
Uniprot Name
Cytochrome P450 2C9
Molecular Weight
55627.365 Da
  1. Gunes A, Coskun U, Boruban C, Gunel N, Babaoglu MO, Sencan O, Bozkurt A, Rane A, Hassan M, Zengil H, Yasar U: Inhibitory effect of 5-fluorouracil on cytochrome P450 2C9 activity in cancer patients. Basic Clin Pharmacol Toxicol. 2006 Feb;98(2):197-200. doi: 10.1111/j.1742-7843.2006.pto_304.x. [Article]
  2. Brown MC: An adverse interaction between warfarin and 5-fluorouracil: A case report and review of the literature. Chemotherapy. 1999 Sep-Oct;45(5):392-5. doi: 10.1159/000007230. [Article]
  3. Gilbar PJ, Brodribb TR: Phenytoin and fluorouracil interaction. Ann Pharmacother. 2001 Nov;35(11):1367-70. doi: 10.1345/aph.1A051. [Article]
  4. Karadag O, Babaoglu MO, Altundag K, Elkiran T, Yasar U, Bozkurt A: 5-Fluorouracil-induced coronary spasm: may inhibition of hyperpolarization factors produced by CYP2C enzymes be the cause? Oncology. 2004;66(6):510-1. doi: 10.1159/000079506. [Article]


Pharmacological action
General Function
Toxic substance binding
Specific Function
Serum albumin, the main protein of plasma, has a good binding capacity for water, Ca(2+), Na(+), K(+), fatty acids, hormones, bilirubin and drugs. Its main function is the regulation of the colloid...
Gene Name
Uniprot ID
Uniprot Name
Serum albumin
Molecular Weight
69365.94 Da
  1. Sulkowska A, Bojko B, Rownicka J, Sulkowski W: Competition of drugs to serum albumin in combination therapy. Biopolymers. 2004 Jun 15;74(3):256-62. [Article]
  2. Bertucci C, Ascoli G, Uccello-Barretta G, Di Bari L, Salvadori P: The binding of 5-fluorouracil to native and modified human serum albumin: UV, CD, and 1H and 19F NMR investigation. J Pharm Biomed Anal. 1995 Aug;13(9):1087-93. [Article]
Pharmacological action
General Function
Serine-type endopeptidase inhibitor activity
Specific Function
Major thyroid hormone transport protein in serum.
Gene Name
Uniprot ID
Uniprot Name
Thyroxine-binding globulin
Molecular Weight
46324.12 Da
  1. CYTOMEL (liothyronine) FDA label [File]


Pharmacological action
General Function
Sodium-independent organic anion transmembrane transporter activity
Specific Function
Mediates sodium-independent multispecific organic anion transport. Transport of prostaglandin E2, prostaglandin F2, tetracycline, bumetanide, estrone sulfate, glutarate, dehydroepiandrosterone sulf...
Gene Name
Uniprot ID
Uniprot Name
Solute carrier family 22 member 7
Molecular Weight
60025.025 Da
  1. Kobayashi Y, Ohshiro N, Sakai R, Ohbayashi M, Kohyama N, Yamamoto T: Transport mechanism and substrate specificity of human organic anion transporter 2 (hOat2 [SLC22A7]). J Pharm Pharmacol. 2005 May;57(5):573-8. [Article]
Pharmacological action
General Function
Nucleoside transmembrane transporter activity
Specific Function
Mediates both influx and efflux of nucleosides across the membrane (equilibrative transporter). It is sensitive (ES) to low concentrations of the inhibitor nitrobenzylmercaptopurine riboside (NBMPR...
Gene Name
Uniprot ID
Uniprot Name
Equilibrative nucleoside transporter 1
Molecular Weight
50218.805 Da
  1. Tsujie M, Nakamori S, Nakahira S, Takahashi Y, Hayashi N, Okami J, Nagano H, Dono K, Umeshita K, Sakon M, Monden M: Human equilibrative nucleoside transporter 1, as a predictor of 5-fluorouracil resistance in human pancreatic cancer. Anticancer Res. 2007 Jul-Aug;27(4B):2241-9. [Article]
Pharmacological action
General Function
Xenobiotic-transporting atpase activity
Specific Function
High-capacity urate exporter functioning in both renal and extrarenal urate excretion. Plays a role in porphyrin homeostasis as it is able to mediates the export of protoporhyrin IX (PPIX) both fro...
Gene Name
Uniprot ID
Uniprot Name
ATP-binding cassette sub-family G member 2
Molecular Weight
72313.47 Da
  1. Yuan J, Lv H, Peng B, Wang C, Yu Y, He Z: Role of BCRP as a biomarker for predicting resistance to 5-fluorouracil in breast cancer. Cancer Chemother Pharmacol. 2009 May;63(6):1103-10. doi: 10.1007/s00280-008-0838-z. Epub 2008 Sep 27. [Article]
Pharmacological action
General Function
Organic anion transmembrane transporter activity
Specific Function
May act as an inducible transporter in the biliary and intestinal excretion of organic anions. Acts as an alternative route for the export of bile acids and glucuronides from cholestatic hepatocyte...
Gene Name
Uniprot ID
Uniprot Name
Canalicular multispecific organic anion transporter 2
Molecular Weight
169341.14 Da
  1. Hagmann W, Jesnowski R, Faissner R, Guo C, Lohr JM: ATP-binding cassette C transporters in human pancreatic carcinoma cell lines. Upregulation in 5-fluorouracil-resistant cells. Pancreatology. 2009;9(1-2):136-44. doi: 10.1159/000178884. Epub 2008 Dec 13. [Article]
Pharmacological action
General Function
Atpase activity, coupled to transmembrane movement of substances
Specific Function
May be an organic anion pump relevant to cellular detoxification.
Gene Name
Uniprot ID
Uniprot Name
Multidrug resistance-associated protein 4
Molecular Weight
149525.33 Da
  1. Hagmann W, Jesnowski R, Faissner R, Guo C, Lohr JM: ATP-binding cassette C transporters in human pancreatic carcinoma cell lines. Upregulation in 5-fluorouracil-resistant cells. Pancreatology. 2009;9(1-2):136-44. doi: 10.1159/000178884. Epub 2008 Dec 13. [Article]
Pharmacological action
General Function
Organic anion transmembrane transporter activity
Specific Function
Acts as a multispecific organic anion pump which can transport nucleotide analogs.
Gene Name
Uniprot ID
Uniprot Name
Multidrug resistance-associated protein 5
Molecular Weight
160658.8 Da
  1. Hagmann W, Jesnowski R, Faissner R, Guo C, Lohr JM: ATP-binding cassette C transporters in human pancreatic carcinoma cell lines. Upregulation in 5-fluorouracil-resistant cells. Pancreatology. 2009;9(1-2):136-44. doi: 10.1159/000178884. Epub 2008 Dec 13. [Article]

Drug created at June 13, 2005 13:24 / Updated at June 27, 2022 14:55