Methylene blue



Methylene blue is an oxidation-reduction agent used for the treatment of pediatric and adult patients with acquired methemoglobinemia.

Brand Names
Hyophen, Phosphasal, Provayblue, Proveblue, Urelle, Uribel, Urimar Reformulated Oct 2013, Urin DS, Urogesic Blue Reformulated Apr 2012, Ustell, Utira
Generic Name
Methylene blue
DrugBank Accession Number

Methylene blue is an oxidation-reduction agent. The intravenous form of methylene blue is approved by the FDA for the treatment of pediatric and adult patients with acquired methemoglobinemia. Historically, it has been widely used in Africa to treat malaria, but now it disappeared when chloroquine (CQ) and other drugs entered the market. Its use as an urinary tract antiseptic has also been investigated.

Methylthioninium chloride (INN, or methylene blue, proposed trade name Rember) is an investigational drug being developed by the University of Aberdeen and TauRx Therapeutics that has been shown in early clinical trials to be an inhibitor of Tau protein aggregation. The drug is of potential interest for the treatment of patients with Alzheimer's disease.

Small Molecule
Approved, Investigational
Average: 319.85
Monoisotopic: 319.0909965
Chemical Formula
  • Azul de metileno
  • Basic Blue 9
  • C.I. basic blue 9
  • Chlorure de méthylthioninium
  • Cloruro de metiltioninio
  • Lowacryl blue 9
  • Methylene blue
  • Methylene blue anhydrous
  • Methylenium ceruleum
  • Methylthioninii chloridum
  • Methylthioninium chloride
  • Solvent blue 8
  • Swiss blue
External IDs
  • C.I. 52015
  • CI 52015
  • CI-52015
  • NSC-617593
  • TRX-0014
  • TRX0014



Indicated for the treatment of pediatric and adult patients with acquired methemoglobinemia.

Other clinical applications of methylene blue include improvement of hypotension associated with various clinical states, an antiseptic in urinary tract infections, treatment of hypoxia and hyperdynamic circulation in cirrhosis of liver and severe hepatopulmonary syndrome, and treatment of ifofosamide induced neurotoxicity.

Accelerate your drug discovery research with the industry’s only fully connected ADMET dataset, ideal for:
Machine Learning
Data Science
Drug Discovery
Accelerate your drug discovery research with our fully connected ADMET dataset
Learn more
Associated Conditions
Associated Therapies
Contraindications & Blackbox Warnings
Contraindications & Blackbox Warnings
With our commercial data, access important information on dangerous risks, contraindications, and adverse effects.
Learn more
Our Blackbox Warnings cover Risks, Contraindications, and Adverse Effects
Learn more

Not Available

Mechanism of action
  • Main mechanism of action involves inhibition of nitric oxide synthase and guanylate cyclase.
  • In Alzheimers Disease: a mechanistic study found that methylene blue oxidizes cysteine sulfhydryl groups on tau to keep tau monomeric. One preclinical treatment study in tauopathy mice reported anti-inflammatory or neuroprotective effects mediated by the Nrf2/antioxidant response element (ARE); another reported insoluble tau reduction and a learning and memory benefit when given early.
  • In Methemoglobinemia: Methylene Blue acts by reacting within RBC to form leukomethylene blue, which is a reducing agent of oxidized hemoglobin converting the ferric ion (fe+++) back to its oxygen-carrying ferrous state(fe++).
  • As antimalarial agent: Methylene Blue, a specific inhibitor of P.falciparum glutathione reductase has the potential to reverse CQ resistance and it prevents the polymerization of haem into haemozoin similar to 4-amino-quinoline antimalarials.
  • For ifosfamide induced neurotoxicity: Methylene blue functions as an alternate electron acceptor. It acts to reverse the NADH inhibition caused by gluconeogenesis in the liver while blocking the transformation of chloroethylamine into chloroacetaldehyde. In addition, it inhibits various amine oxidase activities, which also prevents the formation of chloroacetaldehyde.
AGuanylate cyclase soluble subunit alpha-2
ANitric oxide synthase, brain

Not Available

Volume of distribution

10 mg/kg (in rats).

Protein binding

Methylene blue was reported to bind strongly to rabbit plasma (71–77% of bound drug).


Following distribution into tissues, rapidly reduced to leukomethylene blue (leucomethylthioninium chloride). Metabolism to leucomethylene blue may be less efficient in neonates than in older individuals.

Route of elimination

Excreted in urine and bile. About 75% of an oral dose excreted in urine, primarily as stabilized colorless leukomethylene blue.


5–6.5 hours (after IV dose).


3.0 ± 0.7 L/min.

Adverse Effects
Reduce medical errors
and improve treatment outcomes with our comprehensive & structured data on drug adverse effects.
Learn more
Reduce medical errors & improve treatment outcomes with our adverse effects data
Learn more

LD50 = 1180 mg/kg ( Rat ).

Not Available
Pharmacogenomic Effects/ADRs
Interacting Gene/EnzymeAllele nameGenotype(s)Defining Change(s)Type(s)DescriptionDetails
Glucose-6-phosphate 1-dehydrogenaseVilleurbanneNot Available1000_1002delACCADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseTorunNot Available1006A->GADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSunderlandNot Available105_107delCATADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseIwatsukiNot Available1081G->AADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSerresNot Available1082C->TADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseTondelaNot Available1084_1101delCTGAACGAGCGCAAGGCCADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseLoma LindaNot Available1089C->AADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseAachenNot Available1089C->GADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseTenriNot Available1096A->GADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseMontpellierNot Available1132G>AADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseCalvo MackennaNot Available1138A->GADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseRileyNot Available1139T->CADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseOlomoucNot Available1141T->CADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseTomahNot Available1153T->CADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseLynwoodNot Available1154G->TADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseMadridNot Available1155C->GADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseIowa, Walter Reed, SpringfieldNot Available1156A->GADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseBeverly Hills, Genova, Iwate, Niigata, YamaguchiNot Available1160G->AADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseHartfordNot Available1162A->GADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenasePrahaNot Available1166A->GADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseKrakowNot Available1175T>CADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseWisconsinNot Available1177C->GADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseNashville, Anaheim, PorticiNot Available1178G->AADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseAlhambraNot Available1180G->CADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseBariNot Available1187C->TADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenasePuerto LimonNot Available1192G->AADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseCovao do LoboNot Available1205C>AADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseClinicNot Available1215G->AADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseUtrechtNot Available1225C->TADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSuwalkiNot Available1226C->GADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseRiversideNot Available1228G->TADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseJapan, ShinagawaNot Available1229G->AADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseKawasakiNot Available1229G->CADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseMunichNot Available1231A->GADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseGeorgiaNot Available1284C->AADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSumareNot Available1292T->GADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseTelti/KobeNot Available1318C->TADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSantiago de Cuba, MoriokaNot Available1339G->AADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseHarimaNot Available1358T->AADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseFiguera da FozNot Available1366G->CADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseAmiensNot Available1367A>TADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseBangkok NoiNot Available1376G->T, 1502T->GADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseFukayaNot Available1462G->AADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseCampinasNot Available1463G->TADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseBuenos AiresNot Available1465C>TADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseArakawaNot Available1466C->TADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseBrightonNot Available1488_1490delGAAADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseKozukataNot Available159G->CADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseAmsterdamNot Available180_182delTCTADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseNo nameNot Available202G->A, 376A->G, 1264C>GADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSwanseaNot Available224T->CADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseUrayasuNot Available281_283delAGAADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseVancouverNot Available317C->G544C->T592C->TADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseMt SinaiNot Available376A->G, 1159C->TADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenasePlymouthNot Available488G->AADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseVolendamNot Available514C->TADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseShinshuNot Available527A->GADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseChikugoNot Available535A->TADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseTsukuiNot Available561_563delCTCADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenasePedoplis-CkaroNot Available573C>GADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSantiagoNot Available593G->CADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseMinnesota, Marion, Gastonia, LeJeuneNot Available637G->TADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseCincinnatiNot Available637G->T, 1037A->TADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseHarilaouNot Available648T->GADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseNorth DallasNot Available683_685delACAADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseAsahikawaNot Available695G->AADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseDurhamNot Available713A->GADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseStonybrookNot Available724_729delGGCACTADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseWayneNot Available769C->GADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseAveiroNot Available806G->AADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseCleveland CorumNot Available820G->AADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseLilleNot Available821A>TADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseBangkokNot Available825G>CADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSugaoNot Available826C->TADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseLa JollaNot Available832T->CADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseWexhamNot Available833C->TADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenasePiotrkowNot Available851T>CADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseWest VirginiaNot Available910G->TADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseOmiyaNot Available921G->CADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseNaraNot Available953_976delCCACCAAAGGGTACCTGGAC GACCADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseManhattanNot Available962G->AADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseRehevotNot Available964T->CADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseHoniaraNot Available99A->G / 1360C->TADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseTokyo, FukushimaNot Available1246G->AADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseChathamNot Available1003G->AADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseFushanNot Available1004C->AADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenasePartenopeNot Available1052G->TADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseIerapetraNot Available1057C->TADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseAnadiaNot Available1193A->GADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseAbenoNot Available1220A->CADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSurabayaNot Available1291G->AADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenasePawneeNot Available1316G->CADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseS. AntiocoNot Available1342A->GADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseCassanoNot Available1347G->CADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseHermoupolisNot Available1347G->C / 1360C->TADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseUnion,Maewo, Chinese-2, KaloNot Available1360C->TADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseAndalusNot Available1361G->AADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseCosenzaNot Available1376G->CADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseCanton, Taiwan- Hakka, Gifu-like, Agrigento-likeNot Available1376G->TADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseFloresNot Available1387C->AADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseKaiping, Anant, Dhon, Sapporo-like, WoseraNot Available1388G->AADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseKamogawaNot Available169C->TADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseCostanzoNot Available179T>CADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseAmazoniaNot Available185C->AADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSongklanagarindNot Available196T->AADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseHechiNot Available202G->A / 871G->AADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseNamouruNot Available208T->CADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseBao LocNot Available352T>CADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseCrispimNot Available375G->T, 379G->T383T->C384C>TADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseAcrokorinthosNot Available376A->G / 463C->GADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSanta MariaNot Available376A->G / 542A->TADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseAnanindeuaNot Available376A->G / 871G->AADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseVanua LavaNot Available383T->CADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseValladolidNot Available406C->TADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseBelemNot Available409C->TADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseLiuzhouNot Available442G->AADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseShenzenNot Available473G>AADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseTaipei “Chinese- 3”Not Available493A->GADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseToledoNot Available496C>TADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseNaoneNot Available497G->AADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseNankangNot Available517T->CADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseMiaoliNot Available519C->GADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseMediterranean, Dallas, Panama‚ Sassari, Cagliari, BirminghamNot Available563C->TADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseCoimbra ShundeNot Available592C->TADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseNilgiriNot Available593G>AADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseRadlowoNot Available679C->TADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseRoubaixNot Available811G>CADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseHaikouNot Available835A->GADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseChinese-1Not Available835A->TADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseMizushimaNot Available848A>GADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseOsakaNot Available853C->TADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseViangchan, JammuNot Available871G->AADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSeoulNot Available916G->AADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseLudhianaNot Available929G->AADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseFarroupilhaNot Available977C->AADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseChinese-5Not Available1024C->TADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseRignanoNot Available130G>AADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseOrissaNot Available131C->GADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseG6PDNiceNot Available1380G>CADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseKamiube, KeelungNot Available1387C->TADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseNeapolisNot Available1400C->GADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseAuresNot Available143T->CADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSplitNot Available1442C->GADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseKambosNot Available148C->TADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenasePalestrinaNot Available170G>AADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseMetapontoNot Available172G->AADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseMusashinoNot Available185C->TADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseAsahiNot Available202G->AADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseA- (202), Ferrara INot Available202G->A / 376A->GADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseMurcia OristanoNot Available209A->GADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseUbe KonanNot Available241C->TADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseLagosantoNot Available242G->AADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseGuangzhouNot Available274C->TADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseHammersmithNot Available323T->AADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSinnaiNot Available34G->TADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseA- (680)Not Available376A->G / 680G->TADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseA- (968), Betica,Selma, GuantanamoNot Available376A->G / 968T->CADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSalerno PyrgosNot Available383T>GADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseQuing YanNot Available392G->TADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseLagesNot Available40G->AADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseIleshaNot Available466G->AADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseMahidolNot Available487G->AADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseMalagaNot Available542A->TADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSibariNot Available634A->GADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseMexico CityNot Available680G->AADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseNanningNot Available703C->TADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSeattle, Lodi, Modena, Ferrara II, Athens-likeNot Available844G->CADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseBajo MaumereNot Available844G->TADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseMontalbanoNot Available854G->AADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseKalyan-Kerala, Jamnaga, RohiniNot Available949G->AADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseGaoheNot Available95A->GADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details


Drug Interactions
This information should not be interpreted without the help of a healthcare provider. If you believe you are experiencing an interaction, contact a healthcare provider immediately. The absence of an interaction does not necessarily mean no interactions exist.
1,2-BenzodiazepineThe risk or severity of adverse effects can be increased when Methylene blue is combined with 1,2-Benzodiazepine.
AbacavirAbacavir may decrease the excretion rate of Methylene blue which could result in a higher serum level.
AbametapirThe serum concentration of Methylene blue can be increased when it is combined with Abametapir.
AbataceptThe metabolism of Methylene blue can be increased when combined with Abatacept.
AbciximabThe risk or severity of bleeding and hemorrhage can be increased when Methylene blue is combined with Abciximab.
AbemaciclibThe metabolism of Abemaciclib can be decreased when combined with Methylene blue.
AbirateroneThe serum concentration of Methylene blue can be increased when it is combined with Abiraterone.
AcalabrutinibThe metabolism of Acalabrutinib can be decreased when combined with Methylene blue.
AcarboseMethylene blue may increase the hypoglycemic activities of Acarbose.
AcebutololThe serum concentration of Acebutolol can be increased when it is combined with Methylene blue.
Improve patient outcomes
Build effective decision support tools with the industry’s most comprehensive drug-drug interaction checker.
Learn more
Food Interactions
No interactions found.


Comprehensive & structured drug product info
From application numbers to product codes, connect different identifiers through our commercial datasets.
Learn more
Easily connect various identifiers back to our datasets
Learn more
Product Ingredients
IngredientUNIICASInChI Key
Methylene blue trihydrateT42P99266K7220-79-3XQAXGZLFSSPBMK-UHFFFAOYSA-M
Active Moieties
Product Images
Brand Name Prescription Products
NameDosageStrengthRouteLabellerMarketing StartMarketing EndRegionImage
Methylene BlueInjection, solution10 mg/1mLIntravenousAmerican Regent1990-09-302014-04-01US flag
Methylene BlueInjection10 mg/1mLIntravenousAkorn, Inc.2009-04-01Not applicableUS flag
Methylene BlueInjection10 mg/1mLIntravenousGeneral Injectables & Vaccines, Inc2010-04-012019-08-31US flag
Methylene BlueInjection, solution10 mg/1mLIntravenousAmerican Regent1990-09-302013-11-01US flag
Methylene BlueInjection, solution10 mg/1mLIntravenousAmerican Regent1990-09-302014-04-01US flag
Methylene BlueInjection, solution10 mg/1mLIntravenousAmerican Regent1990-09-302013-11-01US flag
Methylene BlueInjection, solution10 mg/1mLIntravenousGeneral Injectables & Vaccines2010-12-172013-08-01US flag
Methylene Blue Inj 1%Liquid10 mg / mLIntramuscular; IntravenousAllen & Hanburys A Glaxo Canada Ltd. Co.1979-12-311996-09-10Canada flag
Methylene Blue Inj 1% USPLiquid1 %IntravenousDavid Bull Laboratories (Pty) Ltd.1991-12-311999-08-10Canada flag
Methylene Blue Inj 10mg/ml USPLiquid10 mg / mLIntravenousGlaxo Canada Inc1979-12-311996-09-10Canada flag
Over the Counter Products
NameDosageStrengthRouteLabellerMarketing StartMarketing EndRegionImage
Methylene Bleu Liq 1%Liquid1 %OralLaboratoire Atlas Inc1951-12-31Not applicableCanada flag
Methylene Bleu Liq 2%Liquid2 %OralLaboratoire Atlas Inc1951-12-31Not applicableCanada flag
Methylene Blue Solution 1%Liquid1 %Oral; TopicalRougier Pharma Division Of Ratiopharm Inc1981-12-312015-10-01Canada flag
Mixture Products
NameIngredientsDosageRouteLabellerMarketing StartMarketing EndRegionImage
Blue CollyriumMethylene blue (0.2 mg / mL) + Naphazoline hydrochloride (0.5 mg / mL)LiquidOphthalmicSandoz Canada Incorporated1997-05-132019-08-01Canada flag
BUCO-BLEU KOLLUTUVAR, 15 MLMethylene blue (0.15 g/15ml) + Resorcinol (0.075 g/15ml)SolutionTopicalTAB ILAC VE SAGLIK URUNLERI SAN TIC LTD STI2020-08-14Not applicableTurkey flag
Collyre BleuMethylene blue (0.2 mg / mL) + Naphazoline hydrochloride (0.5 mg / mL)Solution / dropsOphthalmicSabex Inc1991-12-311997-11-26Canada flag
Collyre Bleu LaiterMethylene blue (0.2 mg / mL) + Naphazoline nitrate (0.5 mg / mL)Solution / dropsOphthalmicBiocodex Sa1986-12-31Not applicableCanada flag
Eau Resolutive SokerMethylene blue (.1365 mg / 30 g) + Camphor (.715 mg / 30 g) + Cupric sulfate (28.925 mg / 30 g) + Resorcinol (58.565 mg / 30 g) + Zinc sulfate (88.4 mg / 30 g)LiquidTopicalProduits Francais Labs Inc.1930-12-311997-05-30Canada flag
Saprolex TabMethylene blue (10 mg) + Methenamine mandelate (250 mg)TabletOralProduits Francais Labs Inc.1982-12-311997-05-30Canada flag
Unapproved/Other Products
NameIngredientsDosageRouteLabellerMarketing StartMarketing EndRegionImage
Azuphen MbMethylene blue trihydrate (10 mg/1) + Hyoscyamine sulfate dihydrate (0.12 mg/1) + Methenamine (120 mg/1) + Phenyl salicylate (36 mg/1) + Sodium phosphate, monobasic, monohydrate (40.8 mg/1)CapsuleOralBurel Pharmaceuticals, Llc2015-09-282016-11-01US flag
DarcalmaMethylene blue trihydrate (10.8 mg/1) + Hyoscyamine sulfate dihydrate (0.12 mg/1) + Methenamine (81.6 mg/1) + Phenyl salicylate (36.2 mg/1) + Sodium phosphate, monobasic, unspecified form (40.8 mg/1)TabletOralRiver's Edge Pharmaceuticals, LLC2008-12-222011-07-31US flag
DarcalmaMethylene blue trihydrate (10.8 mg/1) + Hyoscyamine sulfate dihydrate (.12 mg/1) + Methenamine (81.6 mg/1) + Phenyl salicylate (36.2 mg/1) + Sodium phosphate, monobasic, unspecified form (40.8 mg/1)TabletOralKylemore Pharmaceuticals, LLC2009-12-012009-12-02US flag
DarpazMethylene blue trihydrate (10.8 mg/1) + Hyoscyamine sulfate dihydrate (.12 mg/1) + Methenamine (81 mg/1) + Phenyl salicylate (32.4 mg/1) + Sodium phosphate, monobasic (40.8 mg/1)TabletOralRiver's Edge Pharmaceuticals, LLC2008-12-012011-05-31US flag
Hyolev MbMethylene blue trihydrate (10.8 mg/1) + Hyoscyamine sulfate dihydrate (0.12 mg/1) + Methenamine (81 mg/1) + Phenyl salicylate (32.4 mg/1) + Sodium phosphate, monobasic, monohydrate (40.8 mg/1)TabletOralBurel Pharmaceuticals, Llc2015-06-262016-11-01US flag
HyophenMethylene blue trihydrate (10.8 mg/1) + Benzoic acid (9 mg/1) + Hyoscyamine sulfate dihydrate (0.12 mg/1) + Methenamine (81.6 mg/1) + Phenyl salicylate (36.2 mg/1)TabletOralBiocomp Pharma, Inc.2010-09-21Not applicableUS flag
HyophenMethylene blue trihydrate (10.8 mg/1) + Benzoic acid (9 mg/1) + Hyoscyamine sulfate dihydrate (0.12 mg/1) + Methenamine (81.6 mg/1) + Phenyl salicylate (36.2 mg/1)TabletOralStar Pharmaceuticals, Llc2010-09-21Not applicableUS flag00076 0901 01 nlmimage10 cc15e64f
Indiomin MbMethylene blue trihydrate (10 mg/1) + Hyoscyamine sulfate dihydrate (0.12 mg/1) + Methenamine (120 mg/1) + Sodium phosphate, monobasic, monohydrate (40.8 mg/1)CapsuleOralBurel Pharmaceuticals, Llc2015-09-282016-10-24US flag
Me NaPhos MB Hyo 1Methylene blue (10.8 mg/1) + Hyoscyamine sulfate (0.12 mg/1) + Methenamine (81.6 mg/1) + Sodium phosphate, monobasic, monohydrate (40.8 mg/1)TabletOralMethod Pharmaceuticals2015-12-01Not applicableUS flag
Methylene BlueMethylene blue trihydrate (10 mg/1mL)Injection, solutionIntravenousAmerican Regent1990-09-302013-11-01US flag


ATC Codes
V03AB17 — Methylthioninium chlorideV04CG05 — Methylthioninium chloride
Drug Categories
Chemical TaxonomyProvided by Classyfire
This compound belongs to the class of organic compounds known as benzothiazines. These are organic compounds containing a benzene fused to a thiazine ring (a six-membered ring with four carbon atoms, one nitrogen atom and one sulfur atom).
Organic compounds
Super Class
Organoheterocyclic compounds
Sub Class
Not Available
Direct Parent
Alternative Parents
Dialkylarylamines / Benzenoids / Heteroaromatic compounds / Azacyclic compounds / Organopnictogen compounds / Organic chloride salts / Hydrocarbon derivatives
Amine / Aromatic heteropolycyclic compound / Azacycle / Benzenoid / Benzothiazine / Dialkylarylamine / Heteroaromatic compound / Hydrocarbon derivative / Organic chloride salt / Organic nitrogen compound
Molecular Framework
Aromatic heteropolycyclic compounds
External Descriptors
organic chloride salt (CHEBI:6872)
Affected organisms
  • Humans and other mammals

Chemical Identifiers

CAS number
InChI Key
3,7-bis(dimethylamino)-5λ⁴-phenothiazin-5-ylium chloride


General References
  1. Ozal E, Kuralay E, Yildirim V, Kilic S, Bolcal C, Kucukarslan N, Gunay C, Demirkilic U, Tatar H: Preoperative methylene blue administration in patients at high risk for vasoplegic syndrome during cardiac surgery. Ann Thorac Surg. 2005 May;79(5):1615-9. [Article]
  2. Tuman KJ, McCarthy RJ, O'Connor CJ, Holm WE, Ivankovich AD: Angiotensin-converting enzyme inhibitors increase vasoconstrictor requirements after cardiopulmonary bypass. Anesth Analg. 1995 Mar;80(3):473-9. [Article]
  3. Meissner PE, Mandi G, Coulibaly B, Witte S, Tapsoba T, Mansmann U, Rengelshausen J, Schiek W, Jahn A, Walter-Sack I, Mikus G, Burhenne J, Riedel KD, Schirmer RH, Kouyate B, Muller O: Methylene blue for malaria in Africa: results from a dose-finding study in combination with chloroquine. Malar J. 2006 Oct 8;5:84. [Article]
  4. Boylston M, Beer D: Methemoglobinemia: a case study. Crit Care Nurse. 2002 Aug;22(4):50-5. [Article]
  5. Pelgrims J, De Vos F, Van den Brande J, Schrijvers D, Prove A, Vermorken JB: Methylene blue in the treatment and prevention of ifosfamide-induced encephalopathy: report of 12 cases and a review of the literature. Br J Cancer. 2000 Jan;82(2):291-4. [Article]
  6. product info [Link]
  7. Article [Link]
  8. article [Link]
  9. Drug info [Link]
  10. Monograph [Link]
  11. msds [Link]
  12. FDA Approved Drug Products: PROVAYBLUE (methylene blue) injection, for intravenous use [Link]
KEGG Compound
PubChem Compound
PubChem Substance

Clinical Trials

Clinical Trials
4CompletedSupportive CareCirrhosis of the Liver / Refractory Shock / Septic Shock / Vasoplegia1
4CompletedTreatmentAcquired Methaemoglobinaemia1
4RecruitingTreatmentDENT IMPLANTS / Lasers1
4RecruitingTreatmentLiver Transplant; Complications / Vasoplegic Syndrome1
4TerminatedPreventionSecretion Removal Above ETT Cuff1
4Unknown StatusSupportive CareSeptic1
3CompletedScreeningColorectal, Cancer1
3CompletedTreatmentBipolar Disorder (BD)1
3Not Yet RecruitingTreatmentSeptic Shock1


Not Available
Not Available
Dosage Forms
Solution / dropsOphthalmic
LiquidOral1 %
LiquidOral2 %
InjectionIntravenous10 mg/1mL
Injection, solutionIntravenous10 mg/1mL
LiquidIntramuscular; Intravenous10 mg / mL
LiquidIntravenous1 %
Injection, solutionIntravenous50 mg/5ml
LiquidIntravenous10 mg / mL
SolutionIntravenous10 mg / mL
SolutionParenteral10 mg / mL
LiquidOral; Topical1 %
Tablet, extended releaseOral25 mg
Injection, solutionIntravenous5 mg/ml
Injection, solutionIntravenous
Tablet, extended releaseOral
InjectionIntravenous5 mg/1mL
Tablet, coatedOral
Tablet, sugar coatedOral
Injection, solutionIntravenous8.81 mg/1ml
Not Available
Not Available


Experimental Properties
melting point (°C)100 to 110 °C (with decomposition)Not Available
Predicted Properties
Water Solubility0.0296 mg/mLALOGPS
pKa (Strongest Basic)2.44ChemAxon
Physiological Charge1ChemAxon
Hydrogen Acceptor Count3ChemAxon
Hydrogen Donor Count0ChemAxon
Polar Surface Area19.37 Å2ChemAxon
Rotatable Bond Count2ChemAxon
Refractivity86.98 m3·mol-1ChemAxon
Polarizability33.1 Å3ChemAxon
Number of Rings3ChemAxon
Rule of FiveYesChemAxon
Ghose FilterYesChemAxon
Veber's RuleYesChemAxon
MDDR-like RuleNoChemAxon
Predicted ADMET Features
Not Available


Mass Spec (NIST)
Not Available
SpectrumSpectrum TypeSplash Key
Predicted MS/MS Spectrum - 10V, Positive (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 20V, Positive (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 40V, Positive (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 10V, Negative (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 20V, Negative (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 40V, Negative (Annotated)Predicted LC-MS/MSNot Available


Accelerate your drug discovery research
with our fully connected ADMET & drug target dataset.
Learn more
Accelerate your drug discovery research with our ADMET & drug target dataset
Learn more
Pharmacological action
General Function
Heme binding
Specific Function
Has guanylyl cyclase on binding to the beta-1 subunit.Isoform 2 acts as a negative regulator of guanylyl cyclase activity as it forms non-functional heterodimers with the beta subunits.
Gene Name
Uniprot ID
Uniprot Name
Guanylate cyclase soluble subunit alpha-2
Molecular Weight
81749.185 Da
  1. Ginimuge PR, Jyothi SD: Methylene blue: revisited. J Anaesthesiol Clin Pharmacol. 2010 Oct;26(4):517-20. [Article]
  2. Evora PR: Methylene Blue Is a Guanylate Cyclase Inhibitor That Does Not Interfere with Nitric Oxide Synthesis. Tex Heart Inst J. 2016 Feb 1;43(1):103. doi: 10.14503/THIJ-15-5629. eCollection 2016 Feb. [Article]
  3. Masaki E, Kondo I: Methylene blue, a soluble guanylyl cyclase inhibitor, reduces the sevoflurane minimum alveolar anesthetic concentration and decreases the brain cyclic guanosine monophosphate content in rats. Anesth Analg. 1999 Aug;89(2):484-9. doi: 10.1097/00000539-199908000-00045. [Article]
  4. Oz M, Lorke DE, Hasan M, Petroianu GA: Cellular and molecular actions of Methylene Blue in the nervous system. Med Res Rev. 2011 Jan;31(1):93-117. doi: 10.1002/med.20177. [Article]
Pharmacological action
General Function
Tetrahydrobiopterin binding
Specific Function
Produces nitric oxide (NO) which is a messenger molecule with diverse functions throughout the body. In the brain and peripheral nervous system, NO displays many properties of a neurotransmitter. P...
Gene Name
Uniprot ID
Uniprot Name
Nitric oxide synthase, brain
Molecular Weight
160969.095 Da
  1. Mayer B, Brunner F, Schmidt K: Inhibition of nitric oxide synthesis by methylene blue. Biochem Pharmacol. 1993 Jan 26;45(2):367-74. doi: 10.1016/0006-2952(93)90072-5. [Article]
  2. Ginimuge PR, Jyothi SD: Methylene blue: revisited. J Anaesthesiol Clin Pharmacol. 2010 Oct;26(4):517-20. [Article]
  3. Volke V, Wegener G, Vasar E, Rosenberg R: Methylene blue inhibits hippocampal nitric oxide synthase activity in vivo. Brain Res. 1999 May 1;826(2):303-5. doi: 10.1016/s0006-8993(99)01253-6. [Article]
  4. Oz M, Lorke DE, Hasan M, Petroianu GA: Cellular and molecular actions of Methylene Blue in the nervous system. Med Res Rev. 2011 Jan;31(1):93-117. doi: 10.1002/med.20177. [Article]


Pharmacological action
Curator comments
In vitro inhibitor. Relevance to humans is unknown.
General Function
Protein homodimerization activity
Specific Function
UDPGT is of major importance in the conjugation and subsequent elimination of potentially toxic xenobiotics and endogenous compounds. This isoform glucuronidates bilirubin IX-alpha to form both the...
Gene Name
Uniprot ID
Uniprot Name
UDP-glucuronosyltransferase 1-4
Molecular Weight
60024.535 Da
  1. FDA Approved Drug Products: PROVAYBLUE (methylene blue) injection, for intravenous use [Link]
Pharmacological action
Curator comments
In vitro inhibitor. Relevance to humans is unknown.
General Function
Retinoic acid binding
Specific Function
UDPGT is of major importance in the conjugation and subsequent elimination of potentially toxic xenobiotics and endogenous compounds. This isoform has specificity for phenols. Isoform 2 lacks trans...
Gene Name
Uniprot ID
Uniprot Name
UDP-glucuronosyltransferase 1-9
Molecular Weight
59940.495 Da
  1. FDA Approved Drug Products: PROVAYBLUE (methylene blue) injection, for intravenous use [Link]
Pharmacological action
Curator comments
In vitro inhibitor. Relevance to humans is unknown.
General Function
Oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen
Specific Function
Cytochromes P450 are a group of heme-thiolate monooxygenases. In liver microsomes, this enzyme is involved in an NADPH-dependent electron transport pathway. It oxidizes a variety of structurally un...
Gene Name
Uniprot ID
Uniprot Name
Cytochrome P450 1A2
Molecular Weight
58293.76 Da
  1. FDA Approved Drug Products: PROVAYBLUE (methylene blue) injection, for intravenous use [Link]
  2. In Vitro Assessment of Methylene Blue Hydrate as a Multiple CYP450 Inhibitor and a Mechanism-Based Inhibitor [Link]
Pharmacological action
Curator comments
In vitro inhibitor. Relevance to humans is unknown.
General Function
Steroid hydroxylase activity
Specific Function
Cytochromes P450 are a group of heme-thiolate monooxygenases. In liver microsomes, this enzyme is involved in an NADPH-dependent electron transport pathway. It oxidizes a variety of structurally un...
Gene Name
Uniprot ID
Uniprot Name
Cytochrome P450 2B6
Molecular Weight
56277.81 Da
  1. In Vitro Assessment of Methylene Blue Hydrate as a Multiple CYP450 Inhibitor and a Mechanism-Based Inhibitor [Link]
  2. FDA Approved Drug Products: PROVAYBLUE (methylene blue) injection, for intravenous use [Link]
Pharmacological action
Curator comments
In vitro inhibitor. Relevance to humans is unknown.
General Function
Steroid hydroxylase activity
Specific Function
Cytochromes P450 are a group of heme-thiolate monooxygenases. In liver microsomes, this enzyme is involved in an NADPH-dependent electron transport pathway. It oxidizes a variety of structurally un...
Gene Name
Uniprot ID
Uniprot Name
Cytochrome P450 2C8
Molecular Weight
55824.275 Da
  1. NIH StatPearls: Cholesterol levels [Link]
  2. FDA Approved Drug Products: PROVAYBLUE (methylene blue) injection, for intravenous use [Link]
Pharmacological action
General Function
Steroid hydroxylase activity
Specific Function
Cytochromes P450 are a group of heme-thiolate monooxygenases. In liver microsomes, this enzyme is involved in an NADPH-dependent electron transport pathway. It oxidizes a variety of structurally un...
Gene Name
Uniprot ID
Uniprot Name
Cytochrome P450 2C9
Molecular Weight
55627.365 Da
  1. NIH StatPearls: Cholesterol levels [Link]
  2. FDA Approved Drug Products: PROVAYBLUE (methylene blue) injection, for intravenous use [Link]
Pharmacological action
Curator comments
In vitro inhibitor. Relevance to humans is unknown.
General Function
Steroid hydroxylase activity
Specific Function
Responsible for the metabolism of a number of therapeutic agents such as the anticonvulsant drug S-mephenytoin, omeprazole, proguanil, certain barbiturates, diazepam, propranolol, citalopram and im...
Gene Name
Uniprot ID
Uniprot Name
Cytochrome P450 2C19
Molecular Weight
55930.545 Da
  1. NIH StatPearls: Cholesterol levels [Link]
  2. FDA Approved Drug Products: PROVAYBLUE (methylene blue) injection, for intravenous use [Link]
Pharmacological action
Curator comments
In vitro inhibitor. Relevance to humans is unknown.
General Function
Vitamin d3 25-hydroxylase activity
Specific Function
Cytochromes P450 are a group of heme-thiolate monooxygenases. In liver microsomes, this enzyme is involved in an NADPH-dependent electron transport pathway. It performs a variety of oxidation react...
Gene Name
Uniprot ID
Uniprot Name
Cytochrome P450 3A4
Molecular Weight
57342.67 Da
  1. NIH StatPearls: Cholesterol levels [Link]
  2. FDA Approved Drug Products: PROVAYBLUE (methylene blue) injection, for intravenous use [Link]
Pharmacological action
Curator comments
In vitro inhibitor. Relevance to humans is unknown.
General Function
Oxygen binding
Specific Function
Cytochromes P450 are a group of heme-thiolate monooxygenases. In liver microsomes, this enzyme is involved in an NADPH-dependent electron transport pathway. It oxidizes a variety of structurally un...
Gene Name
Uniprot ID
Uniprot Name
Cytochrome P450 3A5
Molecular Weight
57108.065 Da
  1. NIH StatPearls: Cholesterol levels [Link]
  2. FDA Approved Drug Products: PROVAYBLUE (methylene blue) injection, for intravenous use [Link]
Pharmacological action
General Function
Riboflavin reductase (nadph) activity
Specific Function
Broad specificity oxidoreductase that catalyzes the NADPH-dependent reduction of a variety of flavins, such as riboflavin, FAD or FMN, biliverdins, methemoglobin and PQQ (pyrroloquinoline quinone)....
Gene Name
Uniprot ID
Uniprot Name
Flavin reductase (NADPH)
Molecular Weight
22119.215 Da
  1. FDA Approved Drug Products: PROVAYBLUE (methylene blue) injection, for intravenous use [Link]
Pharmacological action
General Function
Steroid hydroxylase activity
Specific Function
Responsible for the metabolism of many drugs and environmental chemicals that it oxidizes. It is involved in the metabolism of drugs such as antiarrhythmics, adrenoceptor antagonists, and tricyclic...
Gene Name
Uniprot ID
Uniprot Name
Cytochrome P450 2D6
Molecular Weight
55768.94 Da
  1. FDA Drug Development and Drug Interactions: Table of Substrates, Inhibitors and Inducers [Link]
  2. FDA Approved Drug Products: PROVAYBLUE (methylene blue) injection, for intravenous use [Link]


Pharmacological action
General Function
Toxic substance binding
Specific Function
Serum albumin, the main protein of plasma, has a good binding capacity for water, Ca(2+), Na(+), K(+), fatty acids, hormones, bilirubin and drugs. Its main function is the regulation of the colloid...
Gene Name
Uniprot ID
Uniprot Name
Serum albumin
Molecular Weight
69365.94 Da
  1. He LL, Wang YX, Wu XX, Liu XP, Wang X, Liu B, Wang X: Enhancement of the binding affinity of methylene blue to site I in human serum albumin by cupric and ferric ions. Luminescence. 2015 Dec;30(8):1380-8. doi: 10.1002/bio.2910. Epub 2015 Mar 31. [Article]
  2. Kozaki A, Watanabe J: Dose dependency of apparent volumes of distribution for methylene blue in rabbits. J Pharmacobiodyn. 1981 Jan;4(1):49-57. doi: 10.1248/bpb1978.4.49. [Article]


Pharmacological action
General Function
Xenobiotic-transporting atpase activity
Specific Function
Energy-dependent efflux pump responsible for decreased drug accumulation in multidrug-resistant cells.
Gene Name
Uniprot ID
Uniprot Name
Multidrug resistance protein 1
Molecular Weight
141477.255 Da
  1. Senarathna SM, Page-Sharp M, Crowe A: The Interactions of P-Glycoprotein with Antimalarial Drugs, Including Substrate Affinity, Inhibition and Regulation. PLoS One. 2016 Apr 5;11(4):e0152677. doi: 10.1371/journal.pone.0152677. eCollection 2016. [Article]
  2. Khdair A, Handa H, Mao G, Panyam J: Nanoparticle-mediated combination chemotherapy and photodynamic therapy overcomes tumor drug resistance in vitro. Eur J Pharm Biopharm. 2009 Feb;71(2):214-22. doi: 10.1016/j.ejpb.2008.08.017. Epub 2008 Aug 29. [Article]
  3. FDA Approved Drug Products: PROVAYBLUE (methylene blue) injection, for intravenous use [Link]
Pharmacological action
Curator comments
In vitro inhibition. Relevance to humans is unknown.
General Function
Quaternary ammonium group transmembrane transporter activity
Specific Function
Mediates tubular uptake of organic compounds from circulation. Mediates the influx of agmatine, dopamine, noradrenaline (norepinephrine), serotonin, choline, famotidine, ranitidine, histamin, creat...
Gene Name
Uniprot ID
Uniprot Name
Solute carrier family 22 member 2
Molecular Weight
62579.99 Da
  1. FDA Approved Drug Products: PROVAYBLUE (methylene blue) injection, for intravenous use [Link]
Pharmacological action
Curator comments
In vitro inhibition. Relevance to humans is unknown.
General Function
Drug transmembrane transporter activity
Specific Function
Solute transporter for tetraethylammonium (TEA), 1-methyl-4-phenylpyridinium (MPP), cimetidine, N-methylnicotinamide, metformin, creatinine, guanidine, procainamide, topotecan, estrone sulfate, acy...
Gene Name
Uniprot ID
Uniprot Name
Multidrug and toxin extrusion protein 2
Molecular Weight
65083.915 Da
  1. FDA Approved Drug Products: PROVAYBLUE (methylene blue) injection, for intravenous use [Link]
Pharmacological action
Curator comments
In vitro inhibition. Relevance to humans is unknown.
General Function
Monovalent cation:proton antiporter activity
Specific Function
Solute transporter for tetraethylammonium (TEA), 1-methyl-4-phenylpyridinium (MPP), cimetidine, N-methylnicotinamide (NMN), metformin, creatinine, guanidine, procainamide, topotecan, estrone sulfat...
Gene Name
Uniprot ID
Uniprot Name
Multidrug and toxin extrusion protein 1
Molecular Weight
61921.585 Da
  1. FDA Approved Drug Products: PROVAYBLUE (methylene blue) injection, for intravenous use [Link]

Drug created on October 23, 2015 20:18 / Updated on July 29, 2021 06:27